Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3454

Fgf10 fibroblast growth factor 10 ( MGI:1099809)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3454 EMAGE:3454
Figure 3A of Rallis et al., 2003 [PMID:12736217] . Copyright: This image is from Rallis et al., Development 130:2741-2751 (2003), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 3C of Rallis et al., 2003 [PMID:12736217] . Copyright: This image is from Rallis et al., Development 130:2741-2751 (2003), and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: Black arrow indicates forelimb bud, * indicates expression in forelimb bud.
Expression Pattern Description
Spatial Annotation:
EMAGE:3454Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3454_wholemount_strong_3D_1.wlz
3454_wholemount_possible_3D_1.wlz
3454_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3454_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb bud
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1194639
Entity Detected:Fgf10, fibroblast growth factor 10 ( MGI:1099809)
Sequence:sense strand is shown

>MGI:1194639
GGATACTGACACATTGTGCCTCAGCCTTTCCCCACCTGCCGGGCTGCTGTTGCTGCTTCTTGTTGCTCTT
TTTGGTGTCTTCGTTCCCTGTCACCTGCCAAGCTCTTGGTCAGGACATGGTGTCACAGGAGGCCACCAAC
TGCTCTTCTTCCTCCTCGTCCTTCTCCTCTCCTTCCAGTGCGGGAAGGCATGTGCGGAGCTACAATCACC
TCCAAGGAGATGTCCGCTGGAGAAGGCTGTTCTCCTTCACCAAGTACTTTCTCACGATTGAGAAGAACGG
CAAGGTCAGCGGGACCAAGAATGAAGACTGTCCGTACAGTGTCCTGGAGATAACATCAGTGGAAATCGGA
GTTGTTGCCGTCAAAGCCATCAACAGCAACTATTACTTAGCCATGAACAAGAAGGGGAAACTCTATGGCT
CAAAAGAGTTTAACAACGACTGTAAGCTGAAAGAGAGAATAGAGGAAAATGGATACAACACCTATGCATC
TTTTAACTGGCAGCACAATGGCAGGCAAATGTATGTGGCATTGAATGGAAAAGGAGCTCCCAGGAGAGGA
CAAAAAACA
nt 361 - nt 929 of NM_008002.3
Notes:The Fgf10 probe used in this study by Rallis et al., 2003 [PMID:12736217] is indicated as that originally used by Bellusci et al., 1997 [PMID:9428423] i.e. a "584bp fragment" of "murine Fgf10", "cloned by RT-PCR from E11.5 mouse lung cDNA. The forward primer was +11 to +34 in the rat sequence (5' GGATACTGACACATTGTGCCTCAG 3') and the reverse primer was +574 to +597 (5' TGTTTTTTGTCCTCTCCTGGGAG 3') (Yamasaki et al, 1996 [PMID:8663172] )". Editor's note: When compared against the mouse Fgf10 cDNA RefSeq NM_008002.3, these primers identify a 568 nt fragment as opposed to a 584nt fragment as described by the authors.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Rallis C; Bruneau BG; Del Buono J; Seidman CE; Seidman JG; Nissim S; Tabin CJ; Logan MP, 2003 [PMID:12736217] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.00473] [ PMID:12736217] Rallis C, Bruneau BG, Del Buono J, Seidman CE, Seidman JG, Nissim S, Tabin CJ, Logan MP 2003 Tbx5 is required for forelimb bud formation and continued outgrowth. Development (130):2741-51
 [ PMID:9428423] Bellusci S, Grindley J, Emoto H, Itoh N, Hogan BL 1997 Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development (124):4867-78
 [ doi:10.1074/jbc.271.27.15918] [ PMID:8663172] Yamasaki M, Miyake A, Tagashira S, Itoh N 1996 Structure and expression of the rat mRNA encoding a novel member of the fibroblast growth factor family. J Biol Chem (271):15918-21
Links:MGI:2677745 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI