EMAGE mouse gene expression spatial database

EMAGE:3477

Hhex hematopoietically expressed homeobox ( MGI:96086)
TS14 (16 Somite no.)
in situ hybridisation

Data Images


Fig 1G.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.001] Gene Expr Patterns 4: 521-8, Kolterud A; Wandzioch E; Carlsson L, Lhx2 is expressed in the septum transversum mesenchyme that becomes an integral part of the liver and the formation of these cells is independent of functional Lhx2. Copyright 2004	Fig 1F.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.001] Gene Expr Patterns 4: 521-8, Kolterud A; Wandzioch E; Carlsson L, Lhx2 is expressed in the septum transversum mesenchyme that becomes an integral part of the liver and the formation of these cells is independent of functional Lhx2. Copyright 2004

Expression pattern clarity:
Find spatially similar expression patterns:

Notes:

The approximate section plane of Fig 1G is depicted in the cartoon in Fig 1F.

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

3D mapping

spatial mapping

View mapped 3D expression image

Download individual expression domains:

Download all expression domains:

Find spatially similar expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

septum transversum hepatic component

detected

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	MGI:3052962
Entity Detected:	Hhex, hematopoietically expressed homeobox ( MGI:96086)
Sequence:	sense strand is shown >MGI:3052962 GCGGACGGTGAACGACTACACGCACGCCCTACTCCGCCACGACCCCCTGGGCAAGCCCTTGCTCTGGAGC CCCTTCCTCCAGCGACCTCTGCACAAAAGGAAAGGCGGTCAAGTGAGGTTCTCCAACGACCAGACCGTCG AGCTGGAGAAGAAGTTCGAGACTCAGAAATACCTCTCCCCACCCGAGAGAAAGCGTCTGGCCAAGATGTT GCAGCTCAGTGAGAGACAGGTCAAAACCTGGTTTCAGAATCGCCGAGCTAAATGGAGAAGACTGAAACAG GAGAATCCTCAAAGCAACAAAAAGGATGCGTTGGACAGTTTGGACACTTCCTGTGAGCAGGGTCAAGACT TGCCCAGTGAACAGAATAAAGGTGCCTCTTTGGATCGTTCGCAGTGTTCACCCTCCCCAGCCTCTCAGGA AGACCCCGACTCGGAGATCTCAGAGGATTCCGACCAGGAGGTGGAC
	nt 315 - nt 780 of NM_008245.1
Notes:	The Hhex (Hex) probe used in this study by Kolterud et al., 2004 [PMID:15261829] is described as being "synthesized from a cDNA fragment obtained by rtPCR. The following template was used: Hex (NM_008245 nucleotides 315-780)." Editors Note: The authors do not refer to a version of NM_008245 and as of Feb 2007 there were two versions: NM_008245.1 (816bp - coding region only) and NM_008245.2 (1772bp - coding region plus UTRs). However, as NM_008245.2 was released on 11-FEB-2007 (i.e. after publication date of this paper), the co-ordinates given presumably refer to NM_008245.1.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Staining procedure:

alkaline phosphatase + NBT/BCIP

General Information

Authors:	Kolterud A; Wandzioch E; Carlsson L, 2004 [PMID:15261829] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	non-screen
References:	[ doi:10.1016/j.modgep.2004.03.001] [ PMID:15261829] Kolterud A, Wandzioch E, Carlsson L 2004 Lhx2 is expressed in the septum transversum mesenchyme that becomes an integral part of the liver and the formation of these cells is independent of functional Lhx2. Gene Expr Patterns (4):521-8
Links:	MGI:3052989 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source