Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:354

Wnt1 wingless-related MMTV integration site 1 ( MGI:98953)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:354
Figure 5M of Yoshida et al., 1997 [PMID:9006071] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Transverse section. Dorsal-medial region indicated by arrowheads.
Expression Pattern Description
Spatial Annotation:
EMAGE:354Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
354_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:354_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
telencephalon
not detected not detected
No expression in the roof.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1340506
Entity Detected:Wnt1, wingless-related MMTV integration site 1 ( MGI:98953)
Sequence:sense strand is shown

>MGI:1340506
AGTGGCTGCTTCAGCCCAGCAGCCAGGACAGCGAACCATGCTGCCTGCGGCCCGCCTCCAGACTTATTAG
AGCCAGCCTGGGAACTCGCATCACTGCCCTCACCGCTGTGTCCAGTCCCACCGTCGCGGACAGCAACCAC
AGTCGTCAGAACCGCAGCACAGAACCAGCAAGGCCAGGCAGGCCATGGGGCTCTGGGCGCTGCTGCCCAG
CTGGGTTTCTACTACGTTGCTACTGGCACTGACCGCTCTGCCCGCAGCCCTGGCTGCCAACAGTAGTGGC
CGATGGTGGGGCATCGTGAACATAGCCTCCTCCACGAACCTGTTGACGGATTCCAAGAGTCTGCAGCTGG
TGCTCGAGCCCAGTCTGCAGCTGCTGAGCCGCAAGCAGCGGCGACTGATCCGACAGAACCCGGG
nt 1 - nt 414 of M11943
Notes:The probe used in this study by Yoshida et al., 1997 [PMID:9006071] is indicated as being originally described by Shimamura et al., 1994 [PMID:7925023] as the insert of plasmid pBWnt1-1, "which was constructed by inserting the 415-bp HindIII-BamHI fragment of mouse Wnt-1 cDNA (Fung et al., 1985 [PMID:3018519] ) into a Bluescript vector ".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Yoshida et al., 1997 [PMID:9006071] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9006071] Yoshida M, Suda Y, Matsuo I, Miyamoto N, Takeda N, Kuratani S, Aizawa S 1997 Emx1 and Emx2 functions in development of dorsal telencephalon. Development (124):101-11
 [ PMID:7925023] Shimamura K, Hirano S, McMahon AP, Takeichi M 1994 Wnt-1-dependent regulation of local E-cadherin and alpha N-catenin expression in the embryonic mouse brain. Development (120):2225-34
 [ PMID:3018519] Fung YK, Shackleford GM, Brown AM, Sanders GS, Varmus HE 1985 Nucleotide sequence and expression in vitro of cDNA derived from mRNA of int-1, a provirally activated mouse mammary oncogene. Mol Cell Biol (5):3337-44
Links:MGI:2136378 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE