Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3557

Wt1 Wilms tumor 1 homolog ( MGI:98968)
TS14 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3557
Fig5G.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00188-9] Mech Dev 79: 169-84, Moore AW; Schedl A; McInnes L; Doyle M; Hecksher-Sorensen J; Hastie ND, YAC transgenic analysis reveals Wilms' tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Copyright 1998.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
NOTE: The authors state that the apparent "expression in the head is probably due to probe trapping", therefore this has not been annotated as positive expression in this EMAGE entry.
Expression Pattern Description
Spatial Annotation:
EMAGE:3557Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3557_wholemount_strong_3D_1.wlz
3557_wholemount_moderate_3D_1.wlz
3557_wholemount_possible_3D_1.wlz
3557_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3557_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
septum transversum
detected detected
genitourinary system mesenchyme
detected detected
Present in associated mesenchyme of future mesonephros.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2445298
Entity Detected:Wt1, Wilms tumor 1 homolog ( MGI:98968)
Sequence:sense strand is shown

>MGI:2445298
GACTCACAGGCCCTGGAGAAGCAGCTAACAATGTCTGGTTAGTTAAAAGCCCATTGCCATTTGGTGTGGA
TTTTCTACTGTAAGAAGAGCCATAGCTGATCATGTCCCCCTGACCCTTCCCTTCTTTTTTTATGCTCGTT
TTCGCTGGGGATGGAATTATTGTACCATTTTCTATCATGGAATATTTATAGGCCAGGGCATGTGTATGTG
TCTGCTAATGTAAACTTTGTCATGGTTTCCATTTACTAACAGCAACAGCAAGAAATAAATCAGAGAGCAA
GGCATCGGGGGTGAATCTTGTCTAACATTCCCGAGGTCAGCCAGGCTGCTAACCTGGAAAGCAGGATGTA
GTTCTGCCAGGCAACTTTTAAAGCTCATGCATTTCAAGCAGCTGAAGAAAAAATCAGAACTAACCAGTAC
CTCTGTATAGAAATCTAAAAGAATTTTACCATTCAGTTAATTCAATGTGAACACTGGCACACTGCTCTTA
AGAAACTATGAAGATCTGAGATTTTTTTGTGTATGTTTTTGACTCTTTTGAGTGGTAATCATATGTGTCT
TTATAGATGTACATACCTCCTTGCACAAATGGAGGGG
nt 1240 - nt 1836 of M30393.1
Notes:The Wt1 probe used in this study by Moore et al., 1998 [PMID:10349631] is described as "PKS2-610bp fragment of Wt1 3#8242; UTR (Mundlos et al., 1993 [PMID:8306891] )". Mundlos et al in turn describe the probe as thus: "a subclone (WT-H) of WT33 (Call et al., 1990 [PMID:2154335] ) was used. This probe is a 610 bp HincII/EcoRI fragment cloned into pKSII+. The probe is derived from the 3' untranslated region of WT33, to avoid cross-hybridization of the WT1 zinc fingers with similar sequences in other transcripts." Editors Note: see Fig2A of Call et al or M30393.1 for the insert sequence of WT33 .
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Moore AW; Schedl A; McInnes L; Doyle M; Hecksher-Sorensen J; Hastie ND, 1998 [PMID:10349631] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(98)00188-9] [ PMID:10349631] Moore AW, Schedl A, McInnes L, Doyle M, Hecksher-Sorensen J, Hastie ND 1998 YAC transgenic analysis reveals Wilms' tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech Dev (79):169-84
 [ PMID:8306891] Mundlos S, Pelletier J, Darveau A, Bachmann M, Winterpacht A, Zabel B 1993 Nuclear localization of the protein encoded by the Wilms' tumor gene WT1 in embryonic and adult tissues. Development (119):1329-41
 [ doi:10.1016/0092-8674(90)90601-A] [ PMID:2154335] Call KM, Glaser T, Ito CY, Buckler AJ, Pelletier J, Haber DA, Rose EA, Kral A, Yeger H, Lewis WH 1990 Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms' tumor locus. Cell (60):509-20
Links:MGI:2445695 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI