Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3561

Etv4 ets variant gene 4 (E1A enhancer binding protein, E1AF) ( MGI:99423)
TS12 (8.5 dpc)
in situ hybridisation

Data Images
EMAGE:3561
Figure 1I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00480-4] Mech Dev 108: 191-5, Chotteau-Lelievre A; Dolle P; Peronne V; Coutte L; de Launoit Y; Desbiens X, Expression patterns of the Ets transcription factors from the PEA3 group during early stages of mouse development. Copyright 2001.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: al, allantois; cd, caudal region; hf, headfold.
Expression Pattern Description
Spatial Annotation:
EMAGE:3561Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3561_wholemount_strong_3D_1.wlz
3561_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3561_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
The authors state that expression is similar to that of Etv5 (as shown in MGI:2671147, specimen 1C). Expression is in the caudal region.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2670122
Entity Detected:Etv4, ets variant gene 4 (E1A enhancer binding protein, E1AF) ( MGI:99423)
Sequence:sense strand is shown

>MGI:2670122
ACACCTTCTGCAGCAAATCTCCCGGAAATGGGAGCTTGGGCGAAGCGCTGATGGTCCCGCAGGGAAAGCT
CATGGACCCGGGCTCCCTGCCGCCTTCCGACTCAGAAGATCTCTTCCAGGACCTCAGTCACTTCCAAGAG
ACGTGGCTCGCAGAAGCTCAGGTACCGGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAAAACT
TAGCTTTCCATAGCCCCACCACCAGGATCAAGAAGGAACCCCAGAGTCCCCGCACAGACCCCGCCCTGTC
CTGCAGCAGGAAGCCACCACTCCCCTACCACCATGGAGAGCAGTGCCTTTACTCCAGACAAATCGCCATC
AAGTCCCCCGCTCCCGGTGCCCCTGGACAGTCGCCCCTGCAGCCCTTTTCCAGGGCAGAACAGCAGCAGA
GCCTCCTGAGAGCCTCCAGCTCTTCCCAGTCCCACCCTGGCCACGGGTACCTTGGTGAGCACAGCTCCGT
CTTCCAGCAGCCCGTGGACATGTGCCACTCCTTCACATCTCCTCAGGGAGGGGGCCGGGAACCTCTCCCA
GCCCCCTATCAACACCAACTGTCGGAGCCCTGC
nt 397 - nt 989 of X63190.1
Notes:The Etv4 (Pea3) probe used in this study by Chotteau-Lelievre et al., 2001 [PMID:11578874] was originally described in Chotteau-Lelievre et al., 1997 [PMID:9285689] and was generated by PCR using the primers 5'-CACCCTTCTGCAGCAAATCTCCCGG-3' and 5'-GCAGGGCTCCGACAGTTGGTGTTG-3', producing "593 bp (nt 397 to nt 989; Xin et al., 1992 [PMID:1547944] )". Editors note: X63190.1 is the accompanying GenBank submission by Xin et al for their paper.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:8.5 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Chotteau-Lelievre A; Dolle P; Peronne V; Coutte L; de Launoit Y; Desbiens X, 2001 [PMID:11578874] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00480-4] [ PMID:11578874] Chotteau-Lelievre A, Dolle P, Peronne V, Coutte L, de Launoit Y, Desbiens X 2001 Expression patterns of the Ets transcription factors from the PEA3 group during early stages of mouse development. Mech Dev (108):191-5
 [ doi:10.1038/sj.onc.1201261] [ PMID:9285689] Chotteau-Lievre A, Desbiens X, Pelczar H, Defossez PA, de Launoit Y 1997 Differential expression patterns of the PEA3 group transcription factors through murine embryonic development. Oncogene (15):937-52
 [ doi:10.1101/gad.6.3.481] [ PMID:1547944] Xin JH, Cowie A, Lachance P, Hassell JA 1992 Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells. Genes Dev (6):481-96
Links:MGI:2671155 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI