Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3562

Etv4 ets variant gene 4 (E1A enhancer binding protein, E1AF) ( MGI:99423)
TS14 (8.75 dpc)
in situ hybridisation

Data Images
EMAGE:3562 EMAGE:3562
Figure 1J. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00480-4] Mech Dev 108: 191-5, Chotteau-Lelievre A; Dolle P; Peronne V; Coutte L; de Launoit Y; Desbiens X, Expression patterns of the Ets transcription factors from the PEA3 group during early stages of mouse development. Copyright 2001. Figure 1K. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00480-4] Mech Dev 108: 191-5, Chotteau-Lelievre A; Dolle P; Peronne V; Coutte L; de Launoit Y; Desbiens X, Expression patterns of the Ets transcription factors from the PEA3 group during early stages of mouse development. Copyright 2001.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Fig1K is a dorsal view of the tail of the embryo shown in Fig1J. Author's image annotations: Arrow in Fig1J points to prominent expression in the mesoderm of the forelimb field; cd - caudal region; br - branchial arches; np - neural plate; pm - presomitic mesoderm; lm - lateral mesoderm, so somites.
Expression Pattern Description
Spatial Annotation:
EMAGE:3562Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3562_wholemount_strong_3D_1.wlz
3562_wholemount_moderate_3D_1.wlz
3562_wholemount_possible_3D_1.wlz
3562_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3562_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionalThe authors state that expression is similar to that of Etv5 (as shown in MGI:2671147, specimen 1D). Expression is in the caudal region.
branchial arch
weak weak
future spinal cord neural plate
strong strong
regionalExpression is posterior
unsegmented mesenchyme
detected detected
regionalExpression is posterior
mesenchyme derived from lateral plate
detected detected
regionalExpression is posterior
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2670122
Entity Detected:Etv4, ets variant gene 4 (E1A enhancer binding protein, E1AF) ( MGI:99423)
Sequence:sense strand is shown

>MGI:2670122
ACACCTTCTGCAGCAAATCTCCCGGAAATGGGAGCTTGGGCGAAGCGCTGATGGTCCCGCAGGGAAAGCT
CATGGACCCGGGCTCCCTGCCGCCTTCCGACTCAGAAGATCTCTTCCAGGACCTCAGTCACTTCCAAGAG
ACGTGGCTCGCAGAAGCTCAGGTACCGGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAAAACT
TAGCTTTCCATAGCCCCACCACCAGGATCAAGAAGGAACCCCAGAGTCCCCGCACAGACCCCGCCCTGTC
CTGCAGCAGGAAGCCACCACTCCCCTACCACCATGGAGAGCAGTGCCTTTACTCCAGACAAATCGCCATC
AAGTCCCCCGCTCCCGGTGCCCCTGGACAGTCGCCCCTGCAGCCCTTTTCCAGGGCAGAACAGCAGCAGA
GCCTCCTGAGAGCCTCCAGCTCTTCCCAGTCCCACCCTGGCCACGGGTACCTTGGTGAGCACAGCTCCGT
CTTCCAGCAGCCCGTGGACATGTGCCACTCCTTCACATCTCCTCAGGGAGGGGGCCGGGAACCTCTCCCA
GCCCCCTATCAACACCAACTGTCGGAGCCCTGC
nt 397 - nt 989 of X63190.1
Notes:The Etv4 (Pea3) probe used in this study by Chotteau-Lelievre et al., 2001 [PMID:11578874] was originally described in Chotteau-Lelievre et al., 1997 [PMID:9285689] and was generated by PCR using the primers 5'-CACCCTTCTGCAGCAAATCTCCCGG-3' and 5'-GCAGGGCTCCGACAGTTGGTGTTG-3', producing "593 bp (nt 397 to nt 989; Xin et al., 1992 [PMID:1547944] )". Editors note: X63190.1 is the accompanying GenBank submission by Xin et al for their paper.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:8.75 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Chotteau-Lelievre A; Dolle P; Peronne V; Coutte L; de Launoit Y; Desbiens X, 2001 [PMID:11578874] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00480-4] [ PMID:11578874] Chotteau-Lelievre A, Dolle P, Peronne V, Coutte L, de Launoit Y, Desbiens X 2001 Expression patterns of the Ets transcription factors from the PEA3 group during early stages of mouse development. Mech Dev (108):191-5
 [ doi:10.1038/sj.onc.1201261] [ PMID:9285689] Chotteau-Lievre A, Desbiens X, Pelczar H, Defossez PA, de Launoit Y 1997 Differential expression patterns of the PEA3 group transcription factors through murine embryonic development. Oncogene (15):937-52
 [ doi:10.1101/gad.6.3.481] [ PMID:1547944] Xin JH, Cowie A, Lachance P, Hassell JA 1992 Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells. Genes Dev (6):481-96
Links:MGI:2671155 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI