Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3569

Epha7 Eph receptor A7 ( MGI:95276)
TS14 (17-18 Somite no.)
in situ hybridisation

Data Images
EMAGE:3569 EMAGE:3569
Fig 6ECopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996 Fig 6DCopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: fb - forebrain neural folds; h - heart; ov - otic vesicle; r2-r6 - rhombomeres 2-6; so - somitic expression domain. Figure 6D is a dorsal view of the embryo shown in figure 6E.
Expression Pattern Description
Spatial Annotation:
EMAGE:3569Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3569_wholemount_strong_3D_1.wlz
3569_wholemount_moderate_3D_1.wlz
3569_wholemount_weak_3D_1.wlz
3569_wholemount_possible_3D_1.wlz
3569_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3569_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rhombomere 02
strong strong
homogeneous
rhombomere 03
strong strong
homogeneous
rhombomere 05
strong strong
homogeneous
rhombomere 04
detected detected
homogeneous
rhombomere 06
detected detected
homogeneous
head somite
detected detected
regionalExpression was detected in all somites except the two to three caudal pairs that were the most recent to segregate. Expression was restricted to the most dorsal part of the somites.
trunk somite
detected detected
regionalExpression was detected in all somites except the two to three caudal pairs that were the most recent to segregate. Expression was restricted to the most dorsal part of the somites.
inner ear
detected detected
regionalExpression detected in the otic vesicle.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1336943
Entity Detected:Epha7, Eph receptor A7 ( MGI:95276)
Sequence:sense strand is shown

>MGI:1336943
AAAGATCGGGCGGAAAGGCCAAAGTTTGAGCAGATAGTCGGAATTCTAGACAAAATGATTCGAAACCCAA
GTAGTCTGAAAACACCCCTGGGAACTTGTAGTAGACCCTTAAGCCCTCTTCTGGACCAGAGCACTCCTGA
CTTCACTGCCTTCTGTTCAGTTGGAGAATGGTTGCAAGCTATTAAAATGGAAAGGTATAAGGACAACTTC
ACAGCAGCGGGTTACAACTCACTCGAGTCAGTGGCCAGGATGACTATCGATGATGTGATGAGTTTAGGGA
TCACACTGGTTGGCCATCAAAAGAAGATCATGAGCAGCATCCAGACTATGCGGGCACAAATGTTGCATTT
ACACGGAACAGGCATCCAAGTGTGACACATCGGCCTCCCTCAGATGAGGCTTAAGACTGCAGGAGAACAG
TTCTGGCCTTCAGTATACGCATAGAATGCTGCTAGAAGACAGTTGATATACTGGGTCCTTCCTACAAGAA
AGAGAAGATTTTAGAAGCACCTCCAGACTTGAACTCCTAAGTGCCACCAGAATATACAAAAAGGGAATTT
AG
nt 2855 - nt 3416 of X79082.1
Notes:The Epha7 probe used in this study by Taneja et al., 1996 [PMID:8806819] is described by the authors as "corresponding to regions 2855 to 3416 of MDK1 (Epha7), (Ciossek et al., 1995 [PMID:7824284] ." Editor's Note: X79082.1 was submitted by Ciossek et al to accompany their paper.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:17-18 Somite no.
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, 1996 [PMID:8806819] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1996.0173] [ PMID:8806819] Taneja R, Thisse B, Rijli FM, Thisse C, Bouillet P, Dolle P, Chambon P 1996 The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Dev Biol (177):397-412
 [ PMID:7824284] Ciossek T, Millauer B, Ullrich A 1995 Identification of alternatively spliced mRNAs encoding variants of MDK1, a novel receptor tyrosine kinase expressed in the murine nervous system. Oncogene (10):97-108
Links:MGI:1338214 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI