Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3571

Epha7 Eph receptor A7 ( MGI:95276)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3571 EMAGE:3571 EMAGE:3571 EMAGE:3571 EMAGE:3571
Fig 7ACopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996 Fig 7BCopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996 Fig 7CCopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996 Fig7DCopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996 Fig7ECopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0173] Dev Biol 177: 397-412, Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Copyright 1996

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image annotations: de - dermatome; dm - dermomyotome; fb - forebrain; hb - hindbrain; L - left; md - mandibular arch; my - myotome; n - notochord; ov - otic vesicle; R - right; s - sclerotome; sc - spinal cord; so - somites. (1) cervical somites showing labeling at the boundary between dermatome and myotome; (2) trunk somites showing labeling in dorsal part of the dermamyotome; (3) tail somites where MDK1 has not (yet) been activated.
Expression Pattern Description
Spatial Annotation:
EMAGE:3571EMAGE:3571EMAGE:3571Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3571_voxel_moderate_3D_1.wlz
3571_voxel_notDetected_3D_1.wlz
3571_voxel_strong_3D_1.wlz
3571_voxel_moderate_3D_2.wlz
3571_voxel_notDetected_3D_2.wlz
3571_voxel_strong_3D_2.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3571_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rhombomere 01
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 02
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 03
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 04
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 05
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 06
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 07
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
rhombomere 08
strong strong
regionalSignal was maximal along the dorsal edges of the rhombomeres and extends more ventrally in cells of the ventricular layer.
inner ear
detected detected
trunk somite
detected detected
regionalExpression is detected in the dorsal part of differentiating somites and the boundary between the dermatome and myotome in rostral somites
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1336943
Entity Detected:Epha7, Eph receptor A7 ( MGI:95276)
Sequence:sense strand is shown

>MGI:1336943
AAAGATCGGGCGGAAAGGCCAAAGTTTGAGCAGATAGTCGGAATTCTAGACAAAATGATTCGAAACCCAA
GTAGTCTGAAAACACCCCTGGGAACTTGTAGTAGACCCTTAAGCCCTCTTCTGGACCAGAGCACTCCTGA
CTTCACTGCCTTCTGTTCAGTTGGAGAATGGTTGCAAGCTATTAAAATGGAAAGGTATAAGGACAACTTC
ACAGCAGCGGGTTACAACTCACTCGAGTCAGTGGCCAGGATGACTATCGATGATGTGATGAGTTTAGGGA
TCACACTGGTTGGCCATCAAAAGAAGATCATGAGCAGCATCCAGACTATGCGGGCACAAATGTTGCATTT
ACACGGAACAGGCATCCAAGTGTGACACATCGGCCTCCCTCAGATGAGGCTTAAGACTGCAGGAGAACAG
TTCTGGCCTTCAGTATACGCATAGAATGCTGCTAGAAGACAGTTGATATACTGGGTCCTTCCTACAAGAA
AGAGAAGATTTTAGAAGCACCTCCAGACTTGAACTCCTAAGTGCCACCAGAATATACAAAAAGGGAATTT
AG
nt 2855 - nt 3416 of X79082.1
Notes:The Epha7 probe used in this study by Taneja et al., 1996 [PMID:8806819] is described by the authors as "corresponding to regions 2855 to 3416 of MDK1 (Epha7), (Ciossek et al., 1995 [PMID:7824284] ." Editor's Note: X79082.1 was submitted by Ciossek et al to accompany their paper.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Taneja R; Thisse B; Rijli FM; Thisse C; Bouillet P; Dolle P; Chambon P, 1996 [PMID:8806819] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1996.0173] [ PMID:8806819] Taneja R, Thisse B, Rijli FM, Thisse C, Bouillet P, Dolle P, Chambon P 1996 The expression pattern of the mouse receptor tyrosine kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for rhombomere-specific expression in mouse embryos. Dev Biol (177):397-412
 [ PMID:7824284] Ciossek T, Millauer B, Ullrich A 1995 Identification of alternatively spliced mRNAs encoding variants of MDK1, a novel receptor tyrosine kinase expressed in the murine nervous system. Oncogene (10):97-108
Links:MGI:1338214 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI