Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3606

Alx1 ALX homeobox 1 ( MGI:104621)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3606 EMAGE:3606 EMAGE:3606
Fig1J.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00450-6] Mech Dev 107: 163-7, Beverdam A; Meijlink F, Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Copyright 2001 Fig1-E10.5.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00450-6] Mech Dev 107: 163-7, Beverdam A; Meijlink F, Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Copyright 2001 Fig1K.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00450-6] Mech Dev 107: 163-7, Beverdam A; Meijlink F, Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Copyright 2001

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Arrow in J points to expression of Cart1 in the maxillary process. In the cartoon: LNP, lateral nasal process; Mn, mandibular arch; Mx, maxillary process; O, otocyst; 2nd, 2nd branchial arch. K is a frontal view of a similar stage embryo.
Expression Pattern Description
Spatial Annotation:
EMAGE:3606Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3606_wholemount_strong_3D_1.wlz
3606_wholemount_possible_3D_1.wlz
3606_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3606_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
latero-nasal process mesenchyme
detected detected
medial-nasal process mesenchyme
detected detected
1st branchial arch
detected detected
regionalExpression is in the distal mandibular arch
1st branchial arch maxillary component
detected detected
regionalExpression is in the distal tips of the maxillary process
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:889863
Entity Detected:Alx1, ALX homeobox 1 ( MGI:104621)
Sequence:sense strand is shown

>MGI:889863
CTATCCTTGGGGACAAATGTGACAGCAATGTATCCAGCAGCAAAAAGAGGAGACACCGAACTACCTTTAC
CAGTTTGCAGCTGGAGGAACTGGAGAAAGTTTTCCAGAAAACCCATTACCCAGATGTATATGTCAGAGAA
CAACTTGCCCTGAGAACGGAGCTCACTGAGGCCAGGGTCCAGGTTTGGTTTCAAAATCGAAGGGCCAAGT
GGAGAAAAAGAGAACGATACGGCCAAATACAGCAAGCTAAAAGCCATTTCGCTGCCACGTACGACATATC
AGCCTTACCAAGGACGGACAGCTACCCACAGATCCAGAACAATTTGTGGGCAGGAAATGCTAGCGGTGGT
TCTGTGGTTACGTCATGCATGCTACCACGTGACGCGTCCTCCTGCATGACACCTTACTCTCACTCGCCTC
GGACAGATTCCAGTTATACGGGGTTTTCGAACCACCAGAATCAGTTCAGCCACGTGCCCCTCAATAATTT
TTTCACTGACTCTCTTCTCACTGGAGCTACCAACGGACACGCATTTGAAACAAAGCCGGAGTTTGAAAGG
AGGTCT
Notes:The Cart1 probe used in this study by Beverdam & Meijlink, 2001 [PMID:11520673] is indicated as that used by tenBerge et al, 1998 [PMID:9676189] . tenBerge et al describe the template clone as thus: "Based on its sequence present in the EMBL/Genbank database, an EST clone (Accession No. AA388194) represents a mouse Cart1 cDNA. We purchased this cDNA, cloned in the vector pSport1, from Genome Systems (St. Louis, MO; clone ID 790077) and reconfirmed by sequencing its extreme high similarity at the level of the inferred translation product (65 identical amino acids in a stretch of 66, in comparison to human Cart1". Editor's note: the only publicly available insert sequence of this clone is the short EST read AA388194.1.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Beverdam A; Meijlink F (2001) [PMID:11520673] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00450-6] [ PMID:11520673] Beverdam A, Meijlink F 2001 Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Mech Dev (107):163-7
 [ doi:10.1006/dbio.1998.8921] [ PMID:9676189] ten Berge D, Brouwer A, el Bahi S, GuĂ©net JL, Robert B, Meijlink F 1998 Mouse Alx3: an aristaless-like homeobox gene expressed during embryogenesis in ectomesenchyme and lateral plate mesoderm. Dev Biol (199):11-25
Links:MGI:3039372 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI