Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:361

Pax6 paired box gene 6 ( MGI:97490)
TS15 (9.25 dpc)
in situ hybridisation

Data Images
EMAGE:361
Figure 3C of Grindley et al., 1995 [PMID:7789273] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:361EMAGE:361Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
361_voxel_strong_3D_1.wlz
361_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:361_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
lens placode
detected detected
regionalExpression in lens placode forms part of a larger domain that extends in dorsal-caudal direction.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:29788
Entity Detected:Pax6, paired box gene 6 ( MGI:97490)
Notes:The probe used in this study by Grindley et al., 1995 [PMID:7789273] was made from a "gene-specific 1 kb template for making mouse Pax-6 RNA probe" and "was made by polymerase chain reaction, PCR, from a 1.6 kb cDNA clone, pm1 (Ton et al., 1991 [PMID:1684738] ), using oligonucleotide C128 (ATGGTTTTCTAATCGAAGGG) from the 3' end of the Pax-6 homeobox, and a T7 promoter oligonucleotide (AATACGACTCAC-TATAG) matching vector sequence". See Figure 3A of Ton et al., 1992 [PMID:1612585] to see full sequence of mouse Pax6 and the matching sequence to primer C128.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:Swiss
Age:9.25 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Staining procedure:autoradiography
General Information
Authors:Grindley et al., 1995 [PMID:7789273] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7789273] Grindley JC, Davidson DR, Hill RE 1995 The role of Pax-6 in eye and nasal development. Development (121):1433-42
 [ doi:10.1016/0092-8674(91)90284-6] [ PMID:1684738] Ton CC, Hirvonen H, Miwa H, Weil MM, Monaghan P, Jordan T, van Heyningen V, Hastie ND, Meijers-Heijboer H, Drechsler M 1991 Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell (67):1059-74
Links:MGI:2385724 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI