Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3610

Tle4 transducin-like enhancer of split 4, homolog of Drosophila E(spl) ( MGI:104633)
TS12 (8.5 dpc)
in situ hybridisation

Data Images
EMAGE:3610
Fig3A.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/0925-4773(96)00582-5] Mech Dev 59: 73-87, Koop KE; MacDonald LM; Lobe CG, Transcripts of Grg4, a murine groucho-related gene, are detected in adjacent tissues to other murine neurogenic gene homologues during embryonic development. Copyright 1996

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: Rostral region of the forebrain (fb) is indicated by the concave arrowhead. ms, mesencephalon; mt, metencephalon; my, myelencephalon; ps, primitve streak; p, pharyngeal pouch. Arrows indicate the caudal region of somites.
Expression Pattern Description
Spatial Annotation:
EMAGE:3610Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3610_wholemount_strong_3D_1.wlz
3610_wholemount_moderate_3D_1.wlz
3610_wholemount_weak_3D_1.wlz
3610_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3610_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future spinal cord neural plate
strong strong
regionalExpression is in the neural plate in the primitive streak region.
future prosencephalon
strong strong
future midbrain
strong strong
regionalExpression is in a diffuse band.
future hindbrain
detected detected
regionalExpression is in a diffuse band in the metencephalon and is weakly expressed in two stripes in the myelencephalon.
unsegmented mesenchyme
detected detected
trunk somite
detected detected
regionalExpression is in the newly formed somites and continued in the caudal half of each somite.
1st branchial pouch
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3044199
Entity Detected:Tle4, transducin-like enhancer of split 4, homolog of Drosophila E(spl) ( MGI:104633)
Sequence:sense strand is shown

>MGI:3044199
AGAGCTGACATCCTCAGCCCCTGCCTGCTATGCTCTGGCCATCAGCCCCGACTCCAAGGTCTGCTTCTCA
TGCTGCAGCGACGGTAACATCGCAGTGTGGGATCTGCACAACCAGACTCTGGTGAGGCAATTCCAGGGGC
ACACAGATGGAGCCAGCTGTATTGACATTTCTAATGATGGCACCAAGCTCTGGACAGGTGGTTTGGACAA
CACTGTGAGGTCCTGGGACCTGCGTGAAGGGCGGCAGCTGCAGCAACATGACTTCACCTCTCAGATCTTT
TCATTGGGCTATTGCCCAACTGGAGAGTGGCTTGCAGTGGGGATGGAGAATAGCAATGTGGAAGTATTGC
ATGTCACCAAACCAGACAAATACCAGTTGCATCTTCATGAGAGCTGTGTGCTGTCACTCAAGTTTGCCCA
CTGTGGCAAATGGTTTGTAAGCACTGGAAAGGACAACCTTCTGAATGC
nt 2284 - nt 2751 of NM_011600.2
Notes:The DNA template used for generation of the Tle4 (Grg4) probe used in this study by Koop et al, 1996 [PMID:8892234] "was the 459 bp sequence from the WD40 domain obtained by PCR". This was amplified using the following primers: 5'-TCCTCGGCTCCAGCCTGTTA-3' and 5'-GGCATTGAGAAGGTTGTCTT-3', to produce the 459 bp fragment. Editor's Note: the are a considerable number of base-pair mis-matches between these primer sequences and the Tle4 cDNA RefSeq NM_011600.2. Manual alignment was used to find the start and end co-ordinates within NM_011600.2.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:FVB/N
Age:8.5 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Koop KE; MacDonald LM; Lobe CG (1996) [PMID:8892234] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/0925-4773(96)00582-5] [ PMID:8892234] Koop KE, MacDonald LM, Lobe CG 1996 Transcripts of Grg4, a murine groucho-related gene, are detected in adjacent tissues to other murine neurogenic gene homologues during embryonic development. Mech Dev (59):73-87
Links:MGI:3044222 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI