Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3657

Foxf1a forkhead box F1a ( MGI:1347470)
TS18 (35-40 Somite no.)
in situ hybridisation

Data Images
EMAGE:3657
Figure 1J. Copyright: This image is from Mahlapuu M, Development 2001;128():155-166, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
This embryo has been cleared/clarified using aromatic alcohols to reveal internal structures. Image annotations: in, intestine; li, liver; lu, lung buds; oc, oral cavity; sc, sclerotome.
Expression Pattern Description
Spatial Annotation:
EMAGE:3657Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3657_wholemount_strong_3D_1.wlz
3657_wholemount_moderate_3D_1.wlz
3657_wholemount_weak_3D_1.wlz
3657_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3657_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
trunk somite
detected detected
regionalExpression is in sclerotome
tail somite
detected detected
regionalExpression is in sclerotome
esophagus mesenchyme
detected detected
pharynx mesenchyme
detected detected
stomach mesenchyme
detected detected
foregut-midgut junction mesenchyme
detected detected
hindgut mesenchyme
detected detected
hindgut diverticulum postanal component mesenchyme
detected detected
hindgut diverticulum preanal component mesenchyme
detected detected
midgut loop mesenchyme
detected detected
rest of midgut mesenchyme
detected detected
left lung rudiment mesenchyme
detected detected
right lung rudiment mesenchyme
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1929262
Entity Detected:Foxf1a, forkhead box F1a ( MGI:1347470)
Sequence:sense strand is shown

>MGI:1929262
CGGCCGCGCGGCTTCCGAAGGAAATGCCAGGCGCTCAAGCCTGTGTACAGCATGGTGAACGGGCTGGGCT
TCAACCACCTCCCCGACACCTACGGCTTCCAGGGCTCCGGAGGCCTCTCGTGCGCGCCCAACAGCCTGGC
GCTGGAGGGCGGCTTGGGCATGATGAATGGCCATTTGGCTGGCAACGTGGACGGCATGGCTTTGCCCAGC
CACTCGGTGCCACACCTGCCCTCCAACGGCGGCCACTCGTACATGGGTGGCTGCGGTGGCTCTGCGGCCG
GGGAGTACCCGCACCACGACAGCTCGGTGCCCGCTTCACCGCTGCTGCCGGCCGGCGCCGGCGGAGTCAT
GGAGCCGCACGCCGTTTACTCCAGCTCTGCAGCAGCCTGGCCGCCCGC
nt 343 - nt 740 of NM_010426.1
Notes:The Foxf1a (Foxf1) probe used in this study by Mahlapuu et al., 2001 [PMID:11124112] is described as "a 400 bp NotI/KspI cDNA fragment located immediately 3' of the forkhead box". Editors note: The co-ordinates with respect to NM_010426.1 were deduced from this given information.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:either: (involves: 129P2/OlaHsd * C57BL/6) or (involves: 129P2/OlaHsd * CD-1) or (involves: 129X1/SvJ * C57BL/6)
Age:35-40 Somite no.
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Mahlapuu M; Ormestad M; Enerback S; Carlsson P, 2001 [PMID:11124112] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11124112] Mahlapuu M, Ormestad M, Enerback S, Carlsson P 2001 The forkhead transcription factor Foxf1 is required for differentiation of extra-embryonic and lateral plate mesoderm. Development (128):155-66
Links:MGI:1929300 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI