Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3705

Rhob ras homolog gene family, member B ( MGI:107949)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3705 EMAGE:3705 EMAGE:3705 EMAGE:3705 EMAGE:3705
Figure 2C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 2A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 2B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 2C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 2C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000.
EMAGE:3705
Figure 2E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: Dotted lines indicate level of sections. Arrows in a) point to paraxial mesoderm along the length of the embryo, arrowheads to branchial arches. b) section of the trunk region. R is rostral, C is caudal. Somite boundaries are marked with arrows. c) transverse section through the cranial region. d) section at the level of branchial arches, arrows point to branchial pouches. e) level of aortic sac, arrowheads point to branchial arch arteries as they join the aortic sac. Arrows point to developing motor columns in the ventral part of the neural tube (see also d, and f). f) arrowheads point to developing sensory axons extending fom the ventral aspect of the dorsal root ganglia. Arrow points to developing sympathetic chain adjacent to the paired dorsal aortae. a, dorsal aorta; as, aortic sac; drg, dorsal root ganglia; fg, foregut; nt, neural tube; sv, septum tranversum; 1-3, branchial arches 1,2 and 3; V, trigeminal ganglion; VII, facio-acoustic ganglion; IX, glosso-pharyngeal ganglion. Scale bar in a) 1.1mm; (b-f) 175 microns. Section B was not spatially annotated in this EMAGE entry due to a lack of features which has prevented spatial data placement.
Expression Pattern Description
Spatial Annotation:
EMAGE:3705EMAGE:3705EMAGE:3705EMAGE:3705EMAGE:3705Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mapping3D mapping3D mappingspatial mapping
EMAGE:3705
wholemount mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3705_wholemount_strong_3D_4.wlz
3705_wholemount_moderate_3D_5.wlz
3705_wholemount_weak_3D_5.wlz
3705_wholemount_possible_3D_1.wlz
3705_wholemount_notDetected_3D_5.wlz
3705_voxel_moderate_3D_1.wlz
3705_voxel_weak_3D_1.wlz
3705_voxel_notDetected_3D_1.wlz
3705_voxel_moderate_3D_2.wlz
3705_voxel_weak_3D_2.wlz
3705_voxel_notDetected_3D_2.wlz
3705_voxel_strong_3D_1.wlz
3705_voxel_moderate_3D_3.wlz
3705_voxel_weak_3D_3.wlz
3705_voxel_notDetected_3D_3.wlz
3705_voxel_strong_3D_2.wlz
3705_voxel_moderate_3D_4.wlz
3705_voxel_weak_3D_4.wlz
3705_voxel_notDetected_3D_4.wlz
3705_voxel_strong_3D_3.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3705_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
trunk paraxial mesenchyme
detected detected
branchial arch
detected detected
regionalExpression in streams of cells.
neural tube
detected detected
regionalExpressing cells migrating out of the dorsal part of the neural tube.
trigeminal v ganglion
detected detected
facial vii ganglion
detected detected
glossopharyngeal ix ganglion
detected detected
1st branchial pouch
detected detected
regionalEpithelium of pouches.
2nd branchial pouch
detected detected
regionalEpithelium of pouches.
3rd branchial pouch
detected detected
regionalEpithelium of pouches.
4th branchial pouch
detected detected
regionalEpithelium of pouches.
branchial arch artery
detected detected
outflow tract
detected detected
regionalExpression in aortic sac.
neural tube floor plate
detected detected
regionalExpression in the developing motor columns.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1862033
Entity Detected:Rhob, ras homolog gene family, member B ( MGI:107949)
Sequence:sense strand is shown

>MGI:1862033
CGTGTTCGAGAACTATGTGGCGGACATCGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACG
GCAGGCCAGGAGGACTACGATCGTTTACGGCCGCTCTCCTATCCGGACACCGACGTCATCCTTATGTGCT
TCTCGGTGGACAGCCCGGACTCTCTCGAGAACATCCCCGAGAAGTGGGTGCCCGAGGTAAAGCACTTCTG
CCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACGGAG
CTGGCCCGCATGAAGCAGGAGCCAGTGCGCACGGATGACGGCCGCGCCATGGCGGTGCGCATCCAAGCCT
ATGACTACCTCGAGTGCTCGGCCAAGACCAAGGAGGGCGTGCGCGAGGTTTTTGAGACGGCCACGCGCGC
CGCGCTGCAGAAGCGCTACGGATCCCAGAATGGCTGCATCAACT
nt 4063 - nt 4526 of X99963.1
Notes:The Rhob probe used in this study by Henderson et al., 2000 [PMID:10906464] "was obtained from GenBank [sequence] (accession number x99963) and a 463 bp fragment was amplified by RT-PCR. This corresponds to the region between positions 4063 and 4526 of the cDNA sequence".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Henderson DJ; Ybot-Gonzalez P; Copp AJ, 2000 [PMID:10906464] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(00)00333-6] [ PMID:10906464] Henderson DJ, Ybot-Gonzalez P, Copp AJ 2000 RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo. Mech Dev (95):211-4
Links:MGI:2384277 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI