Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3724

En1 engrailed 1 ( MGI:95389)
TS12 (6-8 Somite no.)
in situ hybridisation

Data Images
EMAGE:3724 EMAGE:3724
Fig 4BCopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0120] Dev Biol 175: 347-57, Avantaggiato V; Acampora D; Tuorto F; Simeone A, Retinoic acid induces stage-specific repatterning of the rostral central nervous system. Copyright 1996 Fig 4ACopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1996.0120] Dev Biol 175: 347-57, Avantaggiato V; Acampora D; Tuorto F; Simeone A, Retinoic acid induces stage-specific repatterning of the rostral central nervous system. Copyright 1996

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Figure 4A' is a brightfield representation of the section shown in Figure 4B. Image annotations: Arrow points to the position corresponding to the Pax-2 posterior border; fb - forebrain; mb - midbrain; hb - hindbrain; fg - foregut.
Expression Pattern Description
Spatial Annotation:
EMAGE:3724EMAGE:3724Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3724_voxel_strong_3D_1.wlz
3724_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3724_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
regionalThe En-1 expression domain includes the the rostral-most hindbrain and posterior two-thirds of the mesencephalon, partially overlapping the Wnt-1 domain.
future hindbrain
detected detected
regionalThe En-1 expression domain includes the the rostral-most hindbrain and posterior two-thirds of the mesencephalon, partially overlapping the Wnt-1 domain.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1339351
Entity Detected:En1, engrailed 1 ( MGI:95389)
Sequence:sense strand is shown

>MGI:1339351
CAGCAGCCGGAGCCTAAAAGTCAGCGCGACTCGGGCCTCGGCGCGGTGGCAGCGGCGGCCCCGAGCGGCC
TCAGTCTGAGTCTGAGCCCAGGAGCCAGCGGCAGCAGCGGCAGCGATGGAGACAGCGTGCCGGTGTCCCC
GCAGCCAGCGCCCCCGTCGCCTCCTGCGGCACCCTGTCTGCCGCCCCTGGCCCATCACCCGCACCTCCCC
CCGCATCCCCCGCCCCCGCCGCCGCCGCCGCCGCCGCCACCGCAGCATCTCGCGGCGCCTGCTCACCAGC
CGCAGCCCGCGGCCCAGCTGCACCGCACCACCAACTTTTTCATCGATAACATCCTAAGGCCCGATTTCGG
TTGCAAAAAGGAACAGCCCCTGCCTCAGCTCCTGGTGGCTTCGGCTGCAGCCGGAGGAGGCGCAGCAGCA
GGAGGAGGAAGCCGCGTGGAGCGTGACCGAGGCCAGACTGGTGCAGGTAGAGACCCCGTTCACTCTCTGG
GCACACGAGCTTCGGGGGCTGCCTCGCTCTTGTGTGCTCCAGATGCGAACT
nt 362 - nt 902 of NM_010133.1
Notes:The En1 probe used in this study by Avantaggiato et al., 1996 [PMID:8626038] is described as a PCR amplified probe spanning the region between amino acids 3 and 183. Editor note: The coordinates with respect to the GenBank En1 cDNA RefSeq NM_010133.1 above were deduced from this information.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:6-8 Somite no.
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:section
Procedures
Staining procedure:autoradiography
General Information
Authors:Avantaggiato V; Acampora D; Tuorto F; Simeone A, 1996 [PMID:8626038] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1996.0120] [ PMID:8626038] Avantaggiato V, Acampora D, Tuorto F, Simeone A 1996 Retinoic acid induces stage-specific repatterning of the rostral central nervous system. Dev Biol (175):347-57
Links:MGI:1339352 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI