Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3769

Fgf10 fibroblast growth factor 10 ( MGI:1099809)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3769 EMAGE:3769
Figure 1O. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00518-9] Mech Dev 100(2):313-6, Bachler M; Neubuser A, Expression of members of the Fgf family and their receptors during midfacial development. Copyright 2001. Figure 1N. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00518-9] Mech Dev 100(2):313-6, Bachler M; Neubuser A, Expression of members of the Fgf family and their receptors during midfacial development. Copyright 2001.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Fig 1N is a frontal view of the nasal region, Fig 1O is a vibratome section through the embryo in Fig 1N.
Expression Pattern Description
Spatial Annotation:
EMAGE:3769EMAGE:3769Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3769_voxel_strong_3D_1.wlz
3769_voxel_moderate_3D_1.wlz
3769_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3769_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
nasal epithelium
detected detected
regionalExpression is in the ectoderm (Fig 1O)
surface ectoderm
detected detected
regionalExpression is in the ectoderm around the nasal pits (Fig 1N).
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1194639
Entity Detected:Fgf10, fibroblast growth factor 10 ( MGI:1099809)
Sequence:sense strand is shown

>MGI:1194639
GGATACTGACACATTGTGCCTCAGCCTTTCCCCACCTGCCGGGCTGCTGTTGCTGCTTCTTGTTGCTCTT
TTTGGTGTCTTCGTTCCCTGTCACCTGCCAAGCTCTTGGTCAGGACATGGTGTCACAGGAGGCCACCAAC
TGCTCTTCTTCCTCCTCGTCCTTCTCCTCTCCTTCCAGTGCGGGAAGGCATGTGCGGAGCTACAATCACC
TCCAAGGAGATGTCCGCTGGAGAAGGCTGTTCTCCTTCACCAAGTACTTTCTCACGATTGAGAAGAACGG
CAAGGTCAGCGGGACCAAGAATGAAGACTGTCCGTACAGTGTCCTGGAGATAACATCAGTGGAAATCGGA
GTTGTTGCCGTCAAAGCCATCAACAGCAACTATTACTTAGCCATGAACAAGAAGGGGAAACTCTATGGCT
CAAAAGAGTTTAACAACGACTGTAAGCTGAAAGAGAGAATAGAGGAAAATGGATACAACACCTATGCATC
TTTTAACTGGCAGCACAATGGCAGGCAAATGTATGTGGCATTGAATGGAAAAGGAGCTCCCAGGAGAGGA
CAAAAAACA
nt 361 - nt 929 of NM_008002.3
Notes:The Fgf10 probe used in this study by Bachler & Neubueser, 2001 [PMID:11165488] is indicated as that described by Bellusci et al, 1997 [PMID:9428423] . i.e. a "584bp fragment" of "murine Fgf10", "cloned by RT-PCR from E11.5 mouse lung cDNA. The forward primer was +11 to +34 in the rat sequence (5' GGATACTGACACATTGTGCCTCAG 3') and the reverse primer was +574 to +597 (5' TGTTTTTTGTCCTCTCCTGGGAG 3') (Yamasaki et al, 1996 [PMID:8663172] )". Editor's note: When compared against the mouse Fgf10 cDNA RefSeq NM_008002.3, these primers identify a 568 nt fragment as opposed to a 584nt fragment as described by the authors..
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Embedding:gelatin/albumin
General Information
Authors:Bachler M; Neubueser A, 2001 [PMID:11165488] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(00)00518-9] [ PMID:11165488] Bachler M, Neubuser A 2001 Expression of members of the Fgf family and their receptors during midfacial development. Mech Dev (100):313-6
 [ PMID:9428423] Bellusci S, Grindley J, Emoto H, Itoh N, Hogan BL 1997 Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development (124):4867-78
 [ doi:10.1074/jbc.271.27.15918] [ PMID:8663172] Yamasaki M, Miyake A, Tagashira S, Itoh N 1996 Structure and expression of the rat mRNA encoding a novel member of the fibroblast growth factor family. J Biol Chem (271):15918-21
Links:MGI:2670360 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI