Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3789

Cer1 cerberus 1 homolog (Xenopus laevis) ( MGI:1201414)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3789
Fig2K.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00323-3] Mech Dev 95: 35-46, Beckers J; Schlautmann N; Gossler A, The mouse rib-vertebrae mutation disrupts anterior-posterior somite patterning and genetically interacts with a delta1 null allele Copyright 2000

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrows point to most recently formed somites, nascent somites.
Expression Pattern Description
Spatial Annotation:
EMAGE:3789Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3789_wholemount_strong_3D_1.wlz
3789_wholemount_moderate_3D_1.wlz
3789_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3789_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk somite
detected detected
regionalExpression in the anterior portion of the recently formed somites.
trunk paraxial mesenchyme
detected detected
regionalExpression in nascent somites, and in a stripe in the presomitic mesoderm.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1261956
Entity Detected:Cer1, cerberus 1 homolog (Xenopus laevis) ( MGI:1201414)
Sequence:sense strand is shown

>MGI:1261956
CTTGGAAGATTCTGGAAGAAACCTGAGACCGAATTTTACCCCCCAAGGGATGTGGAAAGCGATCATGTCT
CATCGGGGATGCAGGCCGTGACTCAGCCAGCAGATGGGAGGAAAGTGGAGAGATCACCTCTACAGGAGGA
AGCCAAGAGGTTCTGGCATCGGTTCATGTTCAGAAAGGGCCCGGCGTTCCAGGGAGTCATCCTGCCCATC
AAAAGCCACGAAGTACACTGGGAGACCTGCAGGACTGTGCCCTTCAACCAGACCATTGCCCATGAAGACT
GTCAAAAAGTCGTTGTCCAGAACAACCTTTGCTTTGGCAAATGCAGTTCCATTCGTTTTCCCGGAGAAGG
GGC
nt 329 - nt 681 of NM_009887.1
Notes:The Cer1 probe used in this study by Beckers et al, 2000 [PMID:10906448] is indicated as that used by Biben et al, 1998 [PMID:9501024] i.e. "probe template for mCer-1 was generated by PCR using primers R1 (5'-cttggaagattctggaagaaacctg-3') x R3 (5'-gccccttctccgggaaaacgaatg-3'), subcloned into Bluescript SK(+). Editors note: The start and end co-ordinates of the probe sequence with respect to the mouse cDNA RefSeq NM_009887.1 were deduced from this information.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Beckers J; Schlautmann N; Gossler A, 2000 [PMID:10906448] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(00)00323-3] [ PMID:10906448] Beckers J, Schlautmann N, Gossler A 2000 The mouse rib-vertebrae mutation disrupts anterior-posterior somite patterning and genetically interacts with a Delta1 null allele. Mech Dev (95):35-46
 [ doi:10.1006/dbio.1997.8812] [ PMID:9501024] Biben C, Stanley E, Fabri L, Kotecha S, Rhinn M, Drinkwater C, Lah M, Wang CC, Nash A, Hilton D, Ang SL, Mohun T, Harvey RP 1998 Murine cerberus homologue mCer-1: a candidate anterior patterning molecule. Dev Biol (194):135-51
Links:MGI:2384650 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI