Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:383

Nid1 nidogen 1 ( MGI:97342)
TS20 (12 dpc)
in situ hybridisation

Data Images
EMAGE:383
Figure 2A of Grindley et al., 1995 [PMID:7789273] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Arrows correspond to condensing mesenchymal cells around the optic cup.
Expression Pattern Description
Spatial Annotation:
EMAGE:383EMAGE:383Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
383_voxel_strong_3D_1.wlz
383_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:383_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
eye
detected detected
regional
lens vesicle
strong strong
Authors report strong expression in lens.
perioptic mesenchyme
detected detected
regionalLower levels of expression in condensing mesenchymal cells around optic cup.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:29790
Entity Detected:Nid1, nidogen 1 ( MGI:97342)
Notes:The Nid1 (entactin) probe used in this study by Grindley et al., 1995 [PMID:7789273] , was made by PCR using "oligonucleotides D932 (CAGTGTCACCACAGCACTGGC) and T3 promoter oligonucleotide (ATTAACCCTCACTAAAG) ", "to amplify a 1.6 kb region at the 3' end of clone p633, a gift of Professor Albert E. Chung". The sequence of p633 is undefined / unreferenced by Grindley.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:Swiss
Age:12 dpc
Theiler Stage:TS20
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Staining procedure:autoradiography
General Information
Authors:Grindley et al., 1995 [PMID:7789273] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7789273] Grindley JC, Davidson DR, Hill RE 1995 The role of Pax-6 in eye and nasal development. Development (121):1433-42
Links:MGI:2385723 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI