Type: | in situ hybridisation probe |
Identifier: | MGI:29790 |
Entity Detected: | Nid1, nidogen 1 ( MGI:97342) |
Notes: | The Nid1 (entactin) probe used in this study by Grindley et al., 1995 [PMID:7789273] , was made by PCR using "oligonucleotides D932 (CAGTGTCACCACAGCACTGGC) and T3 promoter oligonucleotide (ATTAACCCTCACTAAAG) ", "to amplify a 1.6 kb region at the 3' end of clone p633, a gift of Professor Albert E. Chung". The sequence of p633 is undefined / unreferenced by Grindley. |
Chemistry: | RNA |
Strand: | antisense |
Label: | S35 |