Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3863

Cited2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ( MGI:1306784)
TS11 (EHF Downs & Davies)
in situ hybridisation

Data Images
EMAGE:3863 EMAGE:3863
Fig6E (right hand embryo). Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00011-2] Mech Dev 72: 27-40, Dunwoodie SL; Rodriguez TA; Beddington RS, Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Copyright 1998 Fig6F.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00011-2] Mech Dev 72: 27-40, Dunwoodie SL; Rodriguez TA; Beddington RS, Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Copyright 1998

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
The section in 6F is taken from th wholemount stained embryo shown in 6E. Image annotations: (E) anteroproximal endoderm (black arrowhead), head process (black arrows), and developing blood islands (white arrowhead). (F) rostral mesoderm (bracket). mes, mesoderm,: ect, ectoderm; end, endoderm.
Expression Pattern Description
Spatial Annotation:
EMAGE:3863Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3863_wholemount_strong_3D_1.wlz
3863_wholemount_moderate_3D_1.wlz
3863_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3863_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
embryo endoderm
detected detected
regionalExpression is in anterioproximal endoderm.
embryo mesoderm
detected detected
regionalExpression is in the rostral and posterior nascent mesoderm.
blood island
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:324064
Entity Detected:Cited2, Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ( MGI:1306784)
Sequence:sense strand is shown

>MGI:324064
CAGCGCGGGCGGCACGGCNGGTGGCAGCACCATGCCCGCCTCGGTGGCTCACGTCCCCGCGGCAATGCTG
CCGCCCAATGTCATAGACACTGATTTCATCGACGAGGAAGTGCTTATGTCCTTAGTGATAGAAATGGGTT
TGGACCGCATCAAGGAGCTGCCCGAACTCTGGCTGGGCAAAATGAGTTTGATTTTATGACGGACTTCGTG
TGCAAGCAGCAGCCCAGCAGAGTCAGCTGTTGACTCGGTTAACCTCGCAGGCGGAAAGAAATCACCCTCC
CCACCCTAGCCCCACCCCCAACTTCTTCGGTGTGAATTA
nt 1 - nt 320 of AA117983.1
Notes:The Cited2 (Mrg1) probe used in this study by Dunwoodie et al, 1998 [PMID:9533950] was transcribed from either clone AA117983 (IMAGE:537128) or W15571 (IMAGE:333087). The authors state that both riboprobes revealed the same pattern of Mrg1 transcript accumulation.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: C57BL/6 * DBA
Age:EHF Downs & Davies
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Dunwoodie SL; Rodriguez TA; Beddington RS, 1998 [PMID:9533950] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(98)00011-2] [ PMID:9533950] Dunwoodie SL, Rodriguez TA, Beddington RS 1998 Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Mech Dev (72):27-40
Links:MGI:3046868 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI