Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3864

Cited2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ( MGI:1306784)
TS12 (8 Somite no.)
in situ hybridisation

Data Images
EMAGE:3864 EMAGE:3864 EMAGE:3864
Fig7F.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00011-2] Mech Dev 72: 27-40, Dunwoodie SL; Rodriguez TA; Beddington RS, Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Copyright 1998 Fig7E.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00011-2] Mech Dev 72: 27-40, Dunwoodie SL; Rodriguez TA; Beddington RS, Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Copyright 1998 Fig7K.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00011-2] Mech Dev 72: 27-40, Dunwoodie SL; Rodriguez TA; Beddington RS, Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Copyright 1998

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
(F) Lateral view of embryo in (E), presumptive septum transversum; black arrowhead. Cranial neuroectoderm in presumptive midbrain and hindbrain (black arrows). (E) The foregut diverticulum is indicated with an unfilled arrowhead; 1 and 2 = two bands of expression adjacent to the invaginating foregut endoderm. Site 1 is rostral (black arrowhead) and corresponds to the future septum transversum. Site 2 is caudal (white arrow). (K) Midline sagittal section of embryo shown in (E). The myocardium has almost completely engulfed the endocardium bringing the Mrg1 expressing sites 1 (black arrowhead) and 2 (white arrow) into close proximity. Cited2 (Mrg1) is still strongly expressed, at site 1, in the septum transversum (st) and adjacent myocardium (m) but only low levels of transcript persist at site 2. g = foregut.
Expression Pattern Description
Spatial Annotation:
EMAGE:3864Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3864_wholemount_strong_3D_1.wlz
3864_wholemount_possible_3D_1.wlz
3864_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3864_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
trunk mesenchyme
detected detected
regionalExpression in two bands corresponding to the site where the future myocardium adjoins the splanchnic mesoderm, the site of the future septum transversum and at a more caudal site.
cardiovascular system
detected detected
regionalExpression in the presumptive septum transversum.
future midbrain
detected detected
future hindbrain
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:324064
Entity Detected:Cited2, Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ( MGI:1306784)
Sequence:sense strand is shown

>MGI:324064
CAGCGCGGGCGGCACGGCNGGTGGCAGCACCATGCCCGCCTCGGTGGCTCACGTCCCCGCGGCAATGCTG
CCGCCCAATGTCATAGACACTGATTTCATCGACGAGGAAGTGCTTATGTCCTTAGTGATAGAAATGGGTT
TGGACCGCATCAAGGAGCTGCCCGAACTCTGGCTGGGCAAAATGAGTTTGATTTTATGACGGACTTCGTG
TGCAAGCAGCAGCCCAGCAGAGTCAGCTGTTGACTCGGTTAACCTCGCAGGCGGAAAGAAATCACCCTCC
CCACCCTAGCCCCACCCCCAACTTCTTCGGTGTGAATTA
nt 1 - nt 320 of AA117983.1
Notes:The Cited2 (Mrg1) probe used in this study by Dunwoodie et al, 1998 [PMID:9533950] was transcribed from either clone AA117983 (IMAGE:537128) or W15571 (IMAGE:333087). The authors state that both riboprobes revealed the same pattern of Mrg1 transcript accumulation.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: C57BL/6 * DBA
Age:8 Somite no.
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Dunwoodie SL; Rodriguez TA; Beddington RS, 1998 [PMID:9533950] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(98)00011-2] [ PMID:9533950] Dunwoodie SL, Rodriguez TA, Beddington RS 1998 Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Mech Dev (72):27-40
Links:MGI:3046868 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI