Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3865

Cited2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ( MGI:1306784)
TS12 (8 Somite no.)
in situ hybridisation

Data Images
EMAGE:3865
Fig7L.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(98)00011-2] Mech Dev 72: 27-40, Dunwoodie SL; Rodriguez TA; Beddington RS, Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Copyright 1998

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Transverse section through the head of an 8-somite embryo (dorsal to left).
Expression Pattern Description
Spatial Annotation:
EMAGE:3865EMAGE:3865Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3865_voxel_strong_3D_1.wlz
3865_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3865_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future brain
detected detected
regionalExpression is in neural crest which have infiltrated the cranial mesenchyme
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:324064
Entity Detected:Cited2, Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ( MGI:1306784)
Sequence:sense strand is shown

>MGI:324064
CAGCGCGGGCGGCACGGCNGGTGGCAGCACCATGCCCGCCTCGGTGGCTCACGTCCCCGCGGCAATGCTG
CCGCCCAATGTCATAGACACTGATTTCATCGACGAGGAAGTGCTTATGTCCTTAGTGATAGAAATGGGTT
TGGACCGCATCAAGGAGCTGCCCGAACTCTGGCTGGGCAAAATGAGTTTGATTTTATGACGGACTTCGTG
TGCAAGCAGCAGCCCAGCAGAGTCAGCTGTTGACTCGGTTAACCTCGCAGGCGGAAAGAAATCACCCTCC
CCACCCTAGCCCCACCCCCAACTTCTTCGGTGTGAATTA
nt 1 - nt 320 of AA117983.1
Notes:The Cited2 (Mrg1) probe used in this study by Dunwoodie et al, 1998 [PMID:9533950] was transcribed from either clone AA117983 (IMAGE:537128) or W15571 (IMAGE:333087). The authors state that both riboprobes revealed the same pattern of Mrg1 transcript accumulation.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: C57BL/6 * DBA
Age:8 Somite no.
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
General Information
Authors:Dunwoodie SL; Rodriguez TA; Beddington RS, 1998 [PMID:9533950] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(98)00011-2] [ PMID:9533950] Dunwoodie SL, Rodriguez TA, Beddington RS 1998 Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Mech Dev (72):27-40
Links:MGI:3046868 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI