Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3928

Hesx1 homeobox gene expressed in ES cells ( MGI:96071)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3928
Fig3E. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.2000.9757] Dev Biol 223: 422-30, Martinez-Barbera JP; Rodriguez TA; Beddington RS, The homeobox gene Hesx1 is required in the anterior neural ectoderm for normal forebrain formation. Copyright 2000

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
***NOTE: this embryo is double stained for Hesx1(blue/brown) and Fgf8 (orange). Only the sites of Hesx1 are annotated in this EMAGE entry.*** Image annotations: arrowhead points to Fgf8 expression in the commissural plate and the arrow points to Hesx1 expression in the ventral forebrain and Rathke's pouch.
Expression Pattern Description
Spatial Annotation:
EMAGE:3928Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3928_wholemount_strong_3D_1.wlz
3928_wholemount_possible_3D_1.wlz
3928_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3928_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
future forebrain
detected detected
regionalExpression in the ventral forebrain.
rathke's pouch
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1101888
Entity Detected:Hesx1, homeobox gene expressed in ES cells ( MGI:96071)
Sequence:sense strand is shown

>MGI:1101888
CTCCGGGAAAGCAAGCCCGCGCCCTGCTCCTTCTCAATTGAGAGCATTTTAGGACTGGACCAGAAAAAAG
ATTGTACAACGTCAGTAAGACCCCACAGACCCTGGACAGACACCTGCGGTAACTCAGAGAAAGATGGCAA
CCCACCCCTACATGCCCCAGATCTTCCCAGTGAGACTTCATTTCCTTGTCCAGTGGATCACCCAAGGCCA
GAAGAAAGGGCTCCGAAATATGAAAATTATTTTTCAGCCTCCGAAACACGCTCTTTGAAAAGAGAATTGA
GTTGGTACCGAGGACGAAGGCCAAGAACCGCTTTCACCCAGAACCAGGTCGAAGTATTGGAAAATGTCTT
TAGAGTGAACTGCTACCCTGGCATTGACATCAGAGAGGACCTAG
nt 387 - nt 780 of NM_010420.1
Notes:The Hesx1 probe used in this study by Martinez-Barbera et al., 2000 [PMID:10882526] was previously described by Thomas & Beddington, 1996 [PMID:8939602] as follows: "antisense Hesx1 riboprobe was transcribed from a 394bp AluI cDNA fragment spanning positions 30-424 (Webb et al., 1993 [PMID:7904583] )." Editors note: The co-ordinates wrt the Hesx1 cDNA RefSeq NM_010420.1 were deduced by restriction site searching with AluI.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Martinez-Barbera JP; Rodriguez TA; Beddington RS, 2000 [PMID:10882526] , Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.2000.9757] [ PMID:10882526] Martinez-Barbera JP, Rodriguez TA, Beddington RS 2000 The homeobox gene Hesx1 is required in the anterior neural ectoderm for normal forebrain formation. Dev Biol (223):422-30
 [ doi:10.1016/S0960-9822(96)00753-1] [ PMID:8939602] Thomas P, Beddington R 1996 Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Curr Biol (6):1487-96
 [ doi:10.1006/geno.1993.1505] [ PMID:7904583] Webb GC, Thomas PQ, Ford JH, Rathjen PD 1993 Hesx1, a homeobox gene expressed by murine embryonic stem cells, maps to mouse chromosome 14, bands A3-B. Genomics (18):464-6
Links:MGI:1931452 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI