Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3981

Zic3 zinc finger protein of the cerebellum 3 ( MGI:106676)
TS10 (7.0 dpc)
in situ hybridisation

Data Images
EMAGE:3981 EMAGE:3981
Figure 2H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.003] Gene Expr Patterns 4: 505-11, Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Copyright 2004. Figure 2I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.003] Gene Expr Patterns 4: 505-11, Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Copyright 2004.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: Fig2H is a longitudinal section through the 7.0 dpc ("late-streak stage") embryo shown in Fig2I. (See EMAGE:3982 for the accompanying wholemount spatial annotation for Fig2I). Anterior is to left in both images. Image annotations: in (H) n = node, in (I) arrow = expression located in posterior of the embryo, in ectoderm.
Expression Pattern Description
Spatial Annotation:
EMAGE:3981EMAGE:3981Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3981_voxel_strong_3D_1.wlz
3981_voxel_moderate_3D_1.wlz
3981_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3981_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
definitive endoderm
detected detected
regionalExpression is in the anterior definitive endoderm.
embryo ectoderm
detected detected
regionalExpression is in the ectoderm at the anterior of the primitive streak.
node
not detected not detected
homogeneous
amniotic fold mesoderm
not detected not detected
homogeneous
extraembryonic component
not detected not detected
homogeneousThe mesoderm in this region is moving into the extraembryonic portion of the embryo and does not express Zic3 as can be seen in the section shown in Fig. 2H
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3526556
Entity Detected:Zic3, zinc finger protein of the cerebellum 3 ( MGI:106676)
Sequence:sense strand is shown

>MGI:3526556
ATTGAATCCCTTCGGGGACTCAACCCACGCTGCGGCCGCCGCCGCTGCCGCCGCTGCCTTCAAGCTGAGC
CCAGCCACCGCTCACGATCTGTCTTCGGGCCAGAGCTCAGCGTTCACACCGCAGGGTTCAGGTTATGCCA
ATGCCCTGGGCCACCATCACCACCACCATCACCACCATCACGCCAGCCAGGTGCCCACCTACGCGCGGCG
TGCCTCCGCCGCTTTCAACTCCACGCGCGACTTTCTGTTCCGTCAGCGCGGTTCTGGGCTCAGCGAGGCA
GCCTCCGGGGGCGGGCAGCACGGGCTTTTCGCTGGCTCGGCGAGCAGTCTTCACGCTCCAGCTGGTATTC
CTGAGCCTCCTAGCTACTTGCTCTTTCCTGGGCTTCATGAGCAGGGCGCTGGGCACCCGTCGCCCACAGG
GCACGTGGACAACAACCAGGTCCATCTGGGGCTGCGCGGGGAGCTATTTGGCCGTGCAGACCCATACCGC
CCCGTGGCTAGCCCGCGCACGGACCCCTACGCGGCCAGTGCGCAGTTCCCTAACTATAGCCCCATGAACA
TGAACATGGGCGTGAACGTGGCGGCCCACCACGGGCCGGGCGCCTTCTTCCGTTACATGCG
nt 646 - nt 1266 of NM_009575.1
Notes:The Zic3 probe used in this study by Elms et al., 2004 [PMID:15261827] was "a cDNA probe corresponding to bases 646-1266 of mouse Zic3 (Acc No.: NM_009575)".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: 101/HeH * C3H/HeH
Age:7.0 dpc
Theiler Stage:TS10
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
General Information
Authors:Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, 2004 [PMID:15261827] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2004.03.003] [ PMID:15261827] Elms P, Scurry A, Davies J, Willoughby C, Hacker T, Bogani D, Arkell R 2004 Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Gene Expr Patterns (4):505-11
Links:MGI:3526650 same experiment
 EMAGE:3982 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI