Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3984

Zic2 zinc finger protein of the cerebellum 2 ( MGI:106679)
TS17 (10.5 dpc)
immunohistochemistry

Data Images
EMAGE:3984 EMAGE:3984 EMAGE:3984 EMAGE:3984 EMAGE:3984
Figure 2A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00043-7] Gene Expr Patterns 3: 361-7, Brown LY; Kottmann AH; Brown S, Immunolocalization of Zic2 expression in the developing mouse forebrain. Copyright 2003. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00043-7] Gene Expr Patterns 3: 361-7, Brown LY; Kottmann AH; Brown S, Immunolocalization of Zic2 expression in the developing mouse forebrain. Copyright 2003. Figure 2B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00043-7] Gene Expr Patterns 3: 361-7, Brown LY; Kottmann AH; Brown S, Immunolocalization of Zic2 expression in the developing mouse forebrain. Copyright 2003. Figure 2C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00043-7] Gene Expr Patterns 3: 361-7, Brown LY; Kottmann AH; Brown S, Immunolocalization of Zic2 expression in the developing mouse forebrain. Copyright 2003. Figure 2D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00043-7] Gene Expr Patterns 3: 361-7, Brown LY; Kottmann AH; Brown S, Immunolocalization of Zic2 expression in the developing mouse forebrain. Copyright 2003.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: The diagram indicates the plane of sectioning. TV, telencephalic vesicle; OS, optic stalk; RP, roof plate; DRG, dorsal root ganglion.
Expression Pattern Description
Spatial Annotation:
EMAGE:3984EMAGE:3984EMAGE:3984EMAGE:3984Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mapping3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3984_voxel_moderate_3D_1.wlz
3984_voxel_notDetected_3D_1.wlz
3984_voxel_strong_3D_1.wlz
3984_voxel_moderate_3D_2.wlz
3984_voxel_notDetected_3D_2.wlz
3984_voxel_strong_3D_2.wlz
3984_voxel_moderate_3D_3.wlz
3984_voxel_notDetected_3D_3.wlz
3984_voxel_strong_3D_3.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3984_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
forebrain
detected detected
regional2A. Expression is in the dorsal midline of the neural tube and in the alar plates area. 2B & C. Expression is in the dorsal midline of the neural tube.
hindbrain
strong strong
regional2A. Expression is in the dorsal midline of the neural tube and in the alar plates area. Strong expression in roof plate. 2B & C. Expression is in the dorsal midline of the neural tube.
midbrain
detected detected
regional2A. Expression is in the dorsal midline of the neural tube and in the alar plates area. 2B & C. Expression is in the dorsal midline of the neural tube.
diencephalon roof plate
strong strong
2A.
midbrain roof plate
strong strong
2A.
lateral ventricle
strong strong
regional2B & C. Expression is in the medial aspect.
telencephalon
detected detected
graded2B. Expression decreases in a lateral gradient within the pallium.
optic stalk
strong strong
eye
strong strong
neural tube roof plate
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:antibody
Identifier:MGI:2670630
Entity Detected:Zic2, zinc finger protein of the cerebellum 2 ( MGI:106679)
Antigen:sense strand is shown

>MGI:2670630
ASSGYESSTPPGLVSPSAEPQSSSNLSPAAAAAAAAAAAAAAAVSAVHRGGGSGSGGAGGGSGGGSGSGG
GGGGAGGGGGGSSGGGSGTAGGHSGLSSNFNEW
aa 428 - aa 530 of NP_009060.2
Notes:The anti-Zic2 antibody used in this study by Brown et al., 2003 [PMID:12799086] was produced using the following protocol: "PCR was used to amplify a region of human Zic2 consisting of amino acids 428-530 using the following primers: GGATCCTTAGCTCCGGCTATGAGTCG and GAATTCACACGTACCATTCATT, and the fragment was cloned into the GST fusion vector, pGEX (Pharamacia). This plasmid was used to produce protein in Escherichia coli, the resulting protein was purified by binding to glutathione agarose beads and the purified protein was used to immunize rabbits (Covance corporation)." Editor's note: These primers both contain linker sequences at their 5' ends. Note that the antibody was shown by the authors to be specific for Zic2 and it does not cross-react with Zic1 or Zic3.
Antibody Type:polyclonal
Raised In:rabbit
Specimen
Organism:mouse
Strain:C57BL/6J
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
General Information
Authors:Brown LY; Kottmann AH; Brown S, 2003 [PMID:12799086] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S1567-133X(03)00043-7] [ PMID:12799086] Brown LY, Kottmann AH, Brown S 2003 Immunolocalization of Zic2 expression in the developing mouse forebrain. Gene Expr Patterns (3):361-7
Links:MGI:2670634 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI