Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:399

Wnt1 wingless-related MMTV integration site 1 ( MGI:98953)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:399
Figure 2A of Torres et al., 1996 [PMID:8951055] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: d - dorsal; v - ventral.
Expression Pattern Description
Spatial Annotation:
EMAGE:399Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
399_wholemount_strong_3D_1.wlz
399_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:399_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future brain
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:12561
Entity Detected:Wnt1, wingless-related MMTV integration site 1 ( MGI:98953)
Sequence:sense strand is shown

>MGI:12561
CGCAACTGCACGCACACGCGCGTTCTGCACGAGTGTCTATGAGGTGCCGCGCCTCCGGGAACGGGAACGC
TCTCTTCCAGTTCTCAGACACACTCGCTGGTCCTGATGTTTGCCCACCCTACCGCGTCCAGCCACAGTCC
CAGGGTTCATAGCGATCCATCTCTCCCACCTCCTACCTGGGGACTCCTGAAACCACTTGCCTGAGTCGGC
TCGAACCCTTTTGCCATCCTGAGGGCCCTGACCCAGCCTACCTCCCTCCCTCTTTGAGGGAGACTCCTTT
TGCACTGCCCCCCAATTTGGCCAGAGGGTGAGAGAAAGATTCTTCTTCTGGGGTGGGGGTGGGGAGGTCA
ACTCTTGAAGGTGTTGCGGTTCCTGATGTATTTTGCGCTGTGACCTCTTTGGGTATTATCACCTTTCCTT
GTCTCTCGGGTCCCTATAGGTCCCTTGAGTTCTCTAACCAGCACCTCTGGGCTTCAAGG
nt 1256 - nt 1734 of M11943.1
Notes:The Wnt1 (int-1) probe used in this study by Torres et al., 1996 [PMID:8951055] is indicated as being previously described by Wilkinson et al., 1987 [PMID:3594565] ie. as follows: a ~1100bp cDNA clone was isolated that consisted of nt 1256-2208 of the mouse mammary tumor int-1 cDNA clone of Fung et al., (1985) [PMID:3018519] with a 140bp poly(A) tail. "A subclone of the sequences 5' to the StuI site (residue 1732, Fung et al., (1985)), which lacks the long poly(A) tail, was used for the generation of probes."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Torres et al., 1996 [PMID:8951055] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8951055] Torres M, Gomez-Pardo E, Gruss P 1996 Pax2 contributes to inner ear patterning and optic nerve trajectory. Development (122):3381-91
 [ doi:10.1016/0092-8674(87)90664-7] [ PMID:3594565] Wilkinson DG, Bailes JA, McMahon AP 1987 Expression of the proto-oncogene int-1 is restricted to specific neural cells in the developing mouse embryo. Cell (50):79-88
 [ PMID:3018519] Fung YK, Shackleford GM, Brown AM, Sanders GS, Varmus HE 1985 Nucleotide sequence and expression in vitro of cDNA derived from mRNA of int-1, a provirally activated mouse mammary oncogene. Mol Cell Biol (5):3337-44
Links:MGI:1345511 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI