Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:400

Wnt1 wingless-related MMTV integration site 1 ( MGI:98953)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:400
Figure 5K of Theil et al., 1999 [PMID:10409502] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: d - diencephalon; t - telencephalon; arrowhead indicates the anterior limit of Wnt1 expression.
Expression Pattern Description
Spatial Annotation:
EMAGE:400Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
400_wholemount_strong_3D_1.wlz
400_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:400_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionalExpression was detected in the dorsal midline extending from the posterior diencephalon caudally through the entire body axis.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1340506
Entity Detected:Wnt1, wingless-related MMTV integration site 1 ( MGI:98953)
Sequence:sense strand is shown

>MGI:1340506
AGTGGCTGCTTCAGCCCAGCAGCCAGGACAGCGAACCATGCTGCCTGCGGCCCGCCTCCAGACTTATTAG
AGCCAGCCTGGGAACTCGCATCACTGCCCTCACCGCTGTGTCCAGTCCCACCGTCGCGGACAGCAACCAC
AGTCGTCAGAACCGCAGCACAGAACCAGCAAGGCCAGGCAGGCCATGGGGCTCTGGGCGCTGCTGCCCAG
CTGGGTTTCTACTACGTTGCTACTGGCACTGACCGCTCTGCCCGCAGCCCTGGCTGCCAACAGTAGTGGC
CGATGGTGGGGCATCGTGAACATAGCCTCCTCCACGAACCTGTTGACGGATTCCAAGAGTCTGCAGCTGG
TGCTCGAGCCCAGTCTGCAGCTGCTGAGCCGCAAGCAGCGGCGACTGATCCGACAGAACCCGGG
nt 1 - nt 414 of M11943.1
Notes:The Wnt1 probe used in this study by Theil et al.,1999 [PMID:10409502] is indicated as being previously described by Shimamura et al., 1994 [PMID:7925023] ie. as "the 415-bp HindIII-BamHI fragment of mouse Wnt-1 cDNA (Fung et al., 1985 [PMID:3018519] ) "
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Theil et al., 1999 [PMID:10409502] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:3018519] Fung YK, Shackleford GM, Brown AM, Sanders GS, Varmus HE 1985 Nucleotide sequence and expression in vitro of cDNA derived from mRNA of int-1, a provirally activated mouse mammary oncogene. Mol Cell Biol (5):3337-44
 [ PMID:7925023] Shimamura K, Hirano S, McMahon AP, Takeichi M 1994 Wnt-1-dependent regulation of local E-cadherin and alpha N-catenin expression in the embryonic mouse brain. Development (120):2225-34
 [ PMID:10409502] Theil T, Alvarez-Bolado G, Walter A, Ruther U 1999 Gli3 is required for Emx gene expression during dorsal telencephalon development. Development (126):3561-71
Links:MGI:1340541 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI