Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4008

Ascl1 achaete-scute complex homolog 1 (Drosophila) ( MGI:96919)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4008
Fig5A. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1997.8502] Dev Biol 183: 234-42, Yoshikawa Y; Fujimori T; McMahon AP; Takada S, Evidence that absence of Wnt-3a signaling promotes neuralization instead of paraxial mesoderm development in the mouse. Copyright 1997

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotation: FL - forelimb.
Expression Pattern Description
Spatial Annotation:
EMAGE:4008Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4008_wholemount_strong_3D_1.wlz
4008_wholemount_moderate_3D_1.wlz
4008_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4008_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
detected detected
peripheral nervous system
detected detected
mesenchyme
not detected not detected
homogeneous
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1338240
Entity Detected:Ascl1, achaete-scute complex homolog 1 (Drosophila) ( MGI:96919)
Sequence:sense strand is shown

>MGI:1338240
GGATCCTACGACCCTCTTAGCCCAGAGGAACAAGAGCTGCTGGACTTTACCAACTGGTTCTGAGGACCTG
CCAGGCTCTCCTGGGAATGGACTTTGGAAGCAGGATGGCAGCAGATCCTGCATCTTTAGTGTTTCTCGCC
AACGACGTCAAATGGGGAGGCAGAAAAACAAGGGGAAA
nt 1206 - nt 1383 of NM_008553.4
Notes:The Ascl1 (Mash-1) probe used in this study by Yoshikawa et al., 1997 [PMID:9126297] is indicated as that previously described by Lo et al., 1991 [PMID:1909283] i.e. "a 175-bp BamHI fragment containing 60 residues of carboxy-terminal-coding sequence and 115 residues of 3'-untranslated sequence. This probe lies 3' of the bHLH region." When the Ascl1 cDNA RefSeq NM_008553.4 is digested with BamHI, only one cut site is detected (this is approximately 60 residues from the 3' end of the coding region and refers to the 5' end of the probe). It is assumed therefore that the BamHI cut site at the 3' end of the probe is contributed from a linker sequence.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Yoshikawa Y; Fujimori T; McMahon AP; Takada S, 1997 [PMID:9126297] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1997.8502] [ PMID:9126297] Yoshikawa Y, Fujimori T, McMahon AP, Takada S 1997 Evidence that absence of Wnt-3a signaling promotes neuralization instead of paraxial mesoderm development in the mouse. Dev Biol (183):234-42
 [ doi:10.1101/gad.5.9.1524] [ PMID:1909283] Lo LC, Johnson JE, Wuenschell CW, Saito T, Anderson DJ 1991 Mammalian achaete-scute homolog 1 is transiently expressed by spatially restricted subsets of early neuroepithelial and neural crest cells. Genes Dev (5):1524-37
Links:MGI:1338370 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI