Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4026

Zic2 zinc finger protein of the cerebellum 2 ( MGI:106679)
TS08 (pre-streak Downs & Davies)
in situ hybridisation

Data Images
EMAGE:4026 EMAGE:4026 EMAGE:4026
Figure 1B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.003] Gene Expr Patterns 4: 505-11, Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Copyright 2004. Figure 1A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.003] Gene Expr Patterns 4: 505-11, Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Copyright 2004. Figure 1C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.003] Gene Expr Patterns 4: 505-11, Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Copyright 2004.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: Level of sections B and C are shown in A. The corresponding wholemount annotation for A can be found in EMAGE:4025.
Expression Pattern Description
Spatial Annotation:
EMAGE:4026EMAGE:4026EMAGE:4026Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
4026_voxel_notDetected_3D_1.wlz
4026_voxel_strong_3D_1.wlz
4026_voxel_notDetected_3D_2.wlz
4026_voxel_strong_3D_2.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4026_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo endoderm
not detected not detected
homogeneous
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3526555
Entity Detected:Zic2, zinc finger protein of the cerebellum 2 ( MGI:106679)
Sequence:sense strand is shown

>MGI:3526555
GCCATCGGGGTGGGCAGCTTCGCGCGCCACCACCACCACTCGGCCGCGGCAGCGGCGGCTGCGGCGGCCG
AGATGCAGGACCGCGAGCTGAGCCTGGCGGCAGCTCAGAACGGCTTCGTGGACTCGGCCGCGGCGCACAT
GGGCGCCTTCAAGCTCAACCCCGGGGCACACGAACTGTCTCCTGGTCAGAGTTCGGCGTTCACGTCGCAA
GGTCCGGGTGCTTACCCGGGTTCGGCTGCTGCAGCCGCTGCGGCCGCGGCTCTAGGGCCCCACGCCGCAC
ACGTTGGCTCCTATTCGGGGCCTCCCTTTAATTCCACCCGGGACTTCCTGTTCCGCAGCCGGGGCTTCGG
GGACTCGGCGCCGGGAGGCGGGCAGCACGGGCTCTTCGGACCCGGCGCCGGCGGCCTTCACCACGCGCAC
TCGGACGCGCAGGGCCACCTTCTTTTCCCTGGCCTTCCCCCGGAGCAGCACGGGCCGCACGCCTCGCAGA
ACGTGCTCAATGGGCAAATGCGCCTAGGGCTGCCGGGCGAGGTGTTCGGGCGCTCGGAGCAATACCGCCA
AGTGGCCAGCCCGCGGACCGACCCCTACTCGGCGGCGCAGCTCCACAACCAGTACGGCCCTATGAATATG
AACATGGGGATGAACATGGCAGCGGCCGCAGCCCACCACCACCATCACCACCACCACCCTGGTGCCTTTT
TCCGCTACATGCGGCAGCAGTGCATCAAGCAAGAGCTC
nt 273 - nt 1010 of NM_009574.1
Notes:The Zic2 probe template used in this study by Elms et al., 2004 [PMID:15261827] is indicated as that originally described in Elms et al., 2003 [PMID:14651926] i.e. a "cDNA probe corresponding to bases 273-1010 of mouse Zic2 (accession no. NM_009574) was amplified and cloned into pGEM-Teasy (Promega). An antisense riboprobe was generated to this clone by SalI digest and transcription with T7 polymerase". Editors note: Prior to Dec 24 2003 (which includes when Elms et al first described the template sequence), there was only one version of NM_009574 (NM_009574.1).
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: 101/HeH * C3H/HeH
Age:pre-streak Downs & Davies
Theiler Stage:TS08
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
General Information
Authors:Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, 2004 [PMID:15261827] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2004.03.003] [ PMID:15261827] Elms P, Scurry A, Davies J, Willoughby C, Hacker T, Bogani D, Arkell R 2004 Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Gene Expr Patterns (4):505-11
 [ doi:10.1016/j.ydbio.2003.09.005] [ PMID:14651926] Elms P, Siggers P, Napper D, Greenfield A, Arkell R 2003 Zic2 is required for neural crest formation and hindbrain patterning during mouse development. Dev Biol (264):391-406
Links:MGI:3526649 same experiment
 EMAGE:4025 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE