Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4028

Zic2 zinc finger protein of the cerebellum 2 ( MGI:106679)
TS10 (late-streak Downs & Davies)
in situ hybridisation

Data Images
EMAGE:4028 EMAGE:4028
Figure 1G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.003] Gene Expr Patterns 4: 505-11, Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Copyright 2004.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: n, node; level of section in D indicated by the line in G. Corresponding spatial annotation for the section data can be found in EMAGE:4027.
Expression Pattern Description
Spatial Annotation:
EMAGE:4028Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4028_wholemount_strong_3D_1.wlz
4028_wholemount_moderate_3D_1.wlz
4028_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4028_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo ectoderm
detected detected
primitive streak
detected detected
embryo mesoderm
detected detected
regionalExpression is in the emerging mesoderm in the distal two thirds of the embryonic region.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3526555
Entity Detected:Zic2, zinc finger protein of the cerebellum 2 ( MGI:106679)
Sequence:sense strand is shown

>MGI:3526555
GCCATCGGGGTGGGCAGCTTCGCGCGCCACCACCACCACTCGGCCGCGGCAGCGGCGGCTGCGGCGGCCG
AGATGCAGGACCGCGAGCTGAGCCTGGCGGCAGCTCAGAACGGCTTCGTGGACTCGGCCGCGGCGCACAT
GGGCGCCTTCAAGCTCAACCCCGGGGCACACGAACTGTCTCCTGGTCAGAGTTCGGCGTTCACGTCGCAA
GGTCCGGGTGCTTACCCGGGTTCGGCTGCTGCAGCCGCTGCGGCCGCGGCTCTAGGGCCCCACGCCGCAC
ACGTTGGCTCCTATTCGGGGCCTCCCTTTAATTCCACCCGGGACTTCCTGTTCCGCAGCCGGGGCTTCGG
GGACTCGGCGCCGGGAGGCGGGCAGCACGGGCTCTTCGGACCCGGCGCCGGCGGCCTTCACCACGCGCAC
TCGGACGCGCAGGGCCACCTTCTTTTCCCTGGCCTTCCCCCGGAGCAGCACGGGCCGCACGCCTCGCAGA
ACGTGCTCAATGGGCAAATGCGCCTAGGGCTGCCGGGCGAGGTGTTCGGGCGCTCGGAGCAATACCGCCA
AGTGGCCAGCCCGCGGACCGACCCCTACTCGGCGGCGCAGCTCCACAACCAGTACGGCCCTATGAATATG
AACATGGGGATGAACATGGCAGCGGCCGCAGCCCACCACCACCATCACCACCACCACCCTGGTGCCTTTT
TCCGCTACATGCGGCAGCAGTGCATCAAGCAAGAGCTC
nt 273 - nt 1010 of NM_009574.1
Notes:The Zic2 probe template used in this study by Elms et al., 2004 [PMID:15261827] is indicated as that originally described in Elms et al., 2003 [PMID:14651926] i.e. a "cDNA probe corresponding to bases 273-1010 of mouse Zic2 (accession no. NM_009574) was amplified and cloned into pGEM-Teasy (Promega). An antisense riboprobe was generated to this clone by SalI digest and transcription with T7 polymerase". Editors note: Prior to Dec 24 2003 (which includes when Elms et al first described the template sequence), there was only one version of NM_009574 (NM_009574.1).
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: 101/HeH * C3H/HeH
Age:late-streak Downs & Davies
Theiler Stage:TS10
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Elms P; Scurry A; Davies J; Willoughby C; Hacker T; Bogani D; Arkell R, 2004 [PMID:15261827] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2004.03.003] [ PMID:15261827] Elms P, Scurry A, Davies J, Willoughby C, Hacker T, Bogani D, Arkell R 2004 Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Gene Expr Patterns (4):505-11
 [ doi:10.1016/j.ydbio.2003.09.005] [ PMID:14651926] Elms P, Siggers P, Napper D, Greenfield A, Arkell R 2003 Zic2 is required for neural crest formation and hindbrain patterning during mouse development. Dev Biol (264):391-406
Links:MGI:3526649 same experiment
 EMAGE:4027 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI