Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4065

Ran RAN, member RAS oncogene family ( MGI:1333112)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:4065 EMAGE:4065 EMAGE:4065
Fig3E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(02)00007-2] Mech Dev 113: 103-6, Lopez-Casas PP; Lopez-Fernandez LA; Krimer DB; del Mazo J, Ran GTPase expression during early development of the mouse embryo. Copyright 2002 Fig3G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(02)00007-2] Mech Dev 113: 103-6, Lopez-Casas PP; Lopez-Fernandez LA; Krimer DB; del Mazo J, Ran GTPase expression during early development of the mouse embryo. Copyright 2002 Fig3H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(02)00007-2] Mech Dev 113: 103-6, Lopez-Casas PP; Lopez-Fernandez LA; Krimer DB; del Mazo J, Ran GTPase expression during early development of the mouse embryo. Copyright 2002

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Drg - dorsal root ganglion; Gnnt - germinative neuroepithelium of neural tube; Hlb - hindlimb bud. Dashed lines in Fig3E indicate the approximate position of the cryo-sections shown in Fig3G and Fig3H.
Expression Pattern Description
Spatial Annotation:
EMAGE:4065Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4065_wholemount_strong_3D_1.wlz
4065_wholemount_moderate_3D_1.wlz
4065_wholemount_weak_3D_1.wlz
4065_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4065_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
limb
strong strong
gradedA proximal to distal gradation. The strongest expression is at the distal tip of the limb buds.
footplate mesenchyme
detected detected
regionalExpression is in the dorsal and ventral mesenchyme.
future leg mesenchyme
detected detected
regionalExpression is in the dorsal and ventral mesenchyme.
neural tube ventricular layer
detected detected
regionalExpression is in the germ layer within the encephalic vesicle walls.
future spinal cord
detected detected
dorsal root ganglion
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3029296
Entity Detected:Ran, RAN, member RAS oncogene family ( MGI:1333112)
Sequence:sense strand is shown

>MGI:3029296
GGATCCGCCGCGATGGCCGCCCAGGGAGAGCCGCAGGTCCAGTTCAAGCTCGTCCTGGTGGGCGACGGCG
GCACCGGGAAGACAACCTTCGTGAAGCGCCACTTGACGGGCGAGTTTGAGAAGAAGTATGTAGCCACCCT
GGGCGTGGAGGTGCACCCGCTCGTCTTCCATACCAACAGAGGACCCATCAAGTTCAACGTGTGGGACACG
GCCGGCCAGGAGAAGTTCGGGGGCCTGCGCGATGGCTACTACATCCAAGCCCAGTGTGCCATTATAATGT
TTGATGTAACCTCAAGAGTTACTTACAAGAATGTACCTAACTGGCATAGAGATCTGGTACGAGTGTGTGA
AAACATCCCCATTGTATTGTGTGGCAACAAAGTGGATATTAAAGACAGGAAAGTGAAGGCAAAATCTATT
GTCTTCCACCGGAAGAAGAATCTTCAGTACTATGACATTTCTGCCAAAAGTAACTACAACTTTGAAAAGC
CTTTCCTCTGGCTTGCCAGAAAGCTCATTGGAGATCCTAACTTGGAGTTTGTTGCCATGCCTGCTCTTGC
CCCACCTGAGGTGGTCATGGACCCAGCTTTGGCAGCACAGTACGAGCATGATTTAGAGGTTGCTCAGACG
ACTGCTCTCCCAGATGAGGATGATGACCTGTGAGAAAGTGAAGCTGGAGCC
nt 14 - nt 694 of L32751.1
Notes:The Ran probe used in this study by Lopez-Casas et al, 2002 [PMID:11900983] is described as corresponding "to a BamHI/BanII (676 bp) fragment subcloned from mouse Ran/M1 cDNA (Coutavas et al., 1994 [PMID:7849398] )". Editors Note: L32751.1 is the sequence submitted to GenBank for clone M1 of mouse Ran cDNA by Coutavas et al and the start and end co-ordinates w.r.t. to L32751.1 were deduced using this information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:uns
General Information
Authors:Lopez-Casas PP; Lopez-Fernandez LA; Krimer DB; del Mazo J, 2002 [PMID:11900983] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1007/BF00411457] [ PMID:7849398] Coutavas EE, Hsieh CM, Ren M, Drivas GT, Rush MG, D'Eustachio PD 1994 Tissue-specific expression of Ran isoforms in the mouse. Mamm Genome (5):623-8
 [ doi:10.1016/S0925-4773(02)00007-2] [ PMID:11900983] Lopez-Casas PP, Lopez-Fernandez LA, Krimer DB, del Mazo J 2002 Ran GTPase expression during early development of the mouse embryo. Mech Dev (113):103-6
Links:MGI:3029300 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI