Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4139

Bhlhe22 basic helix-loop-helix family, member e22 ( MGI:1930001)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4139 EMAGE:4139
Figure 1D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00135-2] Gene Expr Patterns 3: 755-9, Brunelli S; Innocenzi A; Cossu G, Bhlhb5 is expressed in the CNS and sensory organs during mouse embryonic development. Copyright 2003. Figure 1E,F,G,H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00135-2] Gene Expr Patterns 3: 755-9, Brunelli S; Innocenzi A; Cossu G, Bhlhb5 is expressed in the CNS and sensory organs during mouse embryonic development. Copyright 2003.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: Red lines indicate the level where the embryo was cut to show expression in E-H. Op, otic placode.
Expression Pattern Description
Spatial Annotation:
EMAGE:4139Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4139_wholemount_strong_3D_1.wlz
4139_wholemount_moderate_3D_1.wlz
4139_wholemount_weak_3D_1.wlz
4139_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4139_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forebrain
detected detected
hindbrain
detected detected
midbrain
detected detected
otocyst
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2683748
Entity Detected:Bhlhe22, basic helix-loop-helix family, member e22 ( MGI:1930001)
Notes:The Bhlhb5 probe template used in this study by Brunelli et al., 2003 [PMID:14643684] was "500 bp long, [and] isolated by PCR from 129 genomic DNA with Pfu DNA polymerase (PROMEGA) using the following primers: B5F1, AAGGATCCAGCCTCTCTTCCCAGCTCC; B5R3, AAGAATTCTGTACCTTCCTTGAGATCTAG".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Brunelli S; Innocenzi A; Cossu G, 2003 [PMID:14643684] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S1567-133X(03)00135-2] [ PMID:14643684] Brunelli S, Innocenzi A, Cossu G 2003 Bhlhb5 is expressed in the CNS and sensory organs during mouse embryonic development. Gene Expr Patterns (3):755-9
Links:MGI:2683757 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI