Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4210

Foxc2 forkhead box C2 ( MGI:1347481)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:4210 EMAGE:4210
Fig1C. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1999.9261] Dev Biol 210: 15-29, Furumoto TA; Miura N; Akasaka T; Mizutani-Koseki Y; Sudo H; Fukuda K ; Maekawa M ; Yuasa S ; Fu Y ; Moriya H ; Taniguchi M ; Imai K ; Dahl E ; Balling R ; Pavlova M ; Gossler A ; Koseki H, Notochord-dependent expression of MFH1 and PAX1 cooperates to maintain the proliferation of sclerotome cells during the vertebral column development. Copyright 1999 Fig1G. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1999.9261] Dev Biol 210: 15-29, Furumoto TA; Miura N; Akasaka T; Mizutani-Koseki Y; Sudo H; Fukuda K ; Maekawa M ; Yuasa S ; Fu Y ; Moriya H ; Taniguchi M ; Imai K ; Dahl E ; Balling R ; Pavlova M ; Gossler A ; Koseki H, Notochord-dependent expression of MFH1 and PAX1 cooperates to maintain the proliferation of sclerotome cells during the vertebral column development. Copyright 1999

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Fig1G is a section taken from another embryo (and subjected to radioactive ISH) at the level indicated in Fig1C.
Expression Pattern Description
Spatial Annotation:
EMAGE:4210Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4210_wholemount_strong_3D_1.wlz
4210_wholemount_moderate_3D_1.wlz
4210_wholemount_possible_3D_1.wlz
4210_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4210_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk somite
detected detected
regionalExpression is detected in the posterior region of the sclerotome.
forelimb bud
detected detected
hindlimb bud
detected detected
rib pre-cartilage condensation
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Foxc2_probeC
Entity Detected:Foxc2, forkhead box C2 ( MGI:1347481)
Sequence:sense strand is shown

>Foxc2_probeC
AGATCTCAGCGAGTCCCTCTAAGGGGGATGCAGCCCAGCAAAACGAAATACAGATTTTTTTTTTAATTCC
TTCCCCTACCCAGATGCTGCGCCTGCTCCCTTGGGGCTTCATAGATTAGCTTATGGACCAAACCCATAGG
GACCCCTAATGACTTCTGTGGAGATTCTCCACGGGCGCAAGAGGTCTCTCCGGATAAGGTGCCTTCTGTA
AACGAGTGCGGATTTGTAACCAGGCTATTTTGTTCTTGCCCAGAGCCTTTAATATAATAT
nt 1611 - nt 1880 of S63607.1
Notes:The Foxc2 (Mhf1) probe used in this study by Furumoto et al., 1999 [PMID:10364424] is indicated as that previously described by Miura et al., 1993 [PMID:8325367] i.e. as " transcribed from the SK-MFH270, which contained 270 bp of the 3' untranslated region." The SK-MFH270 is described elsewhere in the paper as follows, "The BglII-DraI fragment (nucleotide 1,611-1,880) of pEF1 was subcloned into BamHI, SmaI digested Bluescript SK(+) and named SK-MFH270." Editors note: S63607.1 was made by GenBank staff at the National Library of Medicine from sequence in the original journal article.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Furumoto TA; Miura N; Akasaka T; Mizutani-Koseki Y; Sudo H; Fukuda K ; Maekawa M ; Yuasa S ; Fu Y ; Moriya H ; Taniguchi M ; Imai K ; Dahl E ; Balling R ; Pavlova M ; Gossler A ; Koseki H, 1999 [PMID:10364424] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1999.9261] [ PMID:10364424] Furumoto TA, Miura N, Akasaka T, Mizutani-Koseki Y, Sudo H, Fukuda K, Maekawa M, Yuasa S, Fu Y, Moriya H, Taniguchi M, Imai K, Dahl E, Balling R, Pavlova M, Gossler A, Koseki H 1999 Notochord-dependent expression of MFH1 and PAX1 cooperates to maintain the proliferation of sclerotome cells during the vertebral column development. Dev Biol (210):15-29
 [ doi:10.1016/0014-5793(93)81785-X] [ PMID:8325367] Miura N, Wanaka A, Tohyama M, Tanaka K 1993 MFH-1, a new member of the fork head domain family, is expressed in developing mesenchyme. FEBS Lett (326):171-6
Links:MGI:1343874 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI