Type: | in situ hybridisation probe |
Identifier: | MGI:3689561 |
Entity Detected: | Flrt2, fibronectin leucine rich transmembrane protein 2 ( MGI:3603594) |
Sequence: | sense strand is shown
>MGI:3689561
AACTGACATGGGTGAAAATGGGCCACAGTCTCGTAGGGGGCATCGTTCAGGAACGAATTGTCAGTGGTGA
GAAGCAACACCTGAGCTTGGTTAATTTAGAGCCCAGATCCACGTATAGGATTTGTTTAGTGCCGCTGGAT
GCGTTCAACTACCGCACTGTGGAAGATACCATCTGTTCGGAGGCTACCACCCATGCCTCTTATTTGAACA
ACGGCAGCAACACTGCTTCTAGCCATGAGCAGACGACTTCCCACAGTATGGGCTCCCCTTTTCTGCTCGC
AGGCTTGATTGGGGGCGCAGTGATTTTTGTGCTCGTTGTCTTGCTCAGCGTCTTTTGCTGGCACATGCAC
AAAAAGGGACGCTACACCTCCCAGAAGTGGAAATACAACCGGGGCCGACGGAAAGACGACTATTGTGAAG
CGGGTACCAAAAAAGACAACTCCATCTTGGAGATGACAGAAACAAGTTTTCAGATTGTCTCCTTAAATAA
CGATCAGCTCCTTAAAGGAGATTTCAGACTGCA
|
| nt 2097 - nt 2619 of NM_201518.2 |
Notes: | The Flrt2 probe used in this study by Haines et al., 2006 [PMID:16872596] is described as follows: "A riboprobe for FLRT2 was transcribed using T3 polymerase from a BamHI digest of the plasmid FLRT2 Pst, which was made by digesting the FLRT2 image clone 553778 with PstI and cloning the 5' most fragment into PstI cut pBluescript II KS (Stratagene)". Editors Note: the start and end points of this probe template were deduced as such: the 5' sequence read of IMAGE:553778 (AA098484.1) was aligned to the mouse Flrt2 mRNA RefSeq NM_201518.2 indicating that the 5' end of the insert of IMAGE:553778 is found at nt2097 in NM_201518.2. Subsequent restriction digestion of NM_201518.2 indicates that PstI cuts at one site 3' to nt2097 (i.e. at nt2619). PstI also cuts IMAGE:553778 in the polylinker adjacent to the SalI cloning site at the 5' end of the insert, therefore the PstI fragment cloned into pBluescript II KS to create FLRT2 Pst is most likely to have spanned nt2097-2619 in NM_201518.2. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |