Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4392

Usp22 ubiquitin specific peptidase 22 ( MGI:2144157)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4392 EMAGE:4392
Fig2B(right). Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2005.07.007] Gene Expr Patterns 6: 277-84, Lee HJ; Kim MS; Shin JM; Park TJ; Chung HM; Baek KH, The expression patterns of deubiquitinating enzymes, USP22 and Usp22. Copyright 2006 Fig2B(left). Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2005.07.007] Gene Expr Patterns 6: 277-84, Lee HJ; Kim MS; Shin JM; Park TJ; Chung HM; Baek KH, The expression patterns of deubiquitinating enzymes, USP22 and Usp22. Copyright 2006

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: forebrain (fb), midbrain (mb), hindbrain (hb), liver (lv), pharyngeal arch (pa), forelimb (fl), tail (tl), and somites (st). Fig2B(left) shows a sense control whereas Fig2B(right) shows a specimen hybridised with anti-sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:4392Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4392_wholemount_strong_3D_1.wlz
4392_wholemount_moderate_3D_1.wlz
4392_wholemount_possible_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4392_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
The authors state there is ubiquitous expression.
forebrain
detected detected
hindbrain
detected detected
midbrain
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3621551
Entity Detected:Usp22, ubiquitin specific peptidase 22 ( MGI:2144157)
Sequence:sense strand is shown

>MGI:3621551
AAGGCAAAGTCCTGTGTCTGCCATGTCTGCGGCATCCACCTGAACCGGCTGCACTCTTGCCTCTACTGTG
TCTTCTTTGGCTGTTTCACGAAGAAGCACATCCATGACCATGCCAAGTCAAAGCGACACAACCTGGCCAT
CGACCTGATGTACGGAGGTATTTACTGCTTCTTGTGTCAGGACTACATCTATGACAAAGACATAGAAATC
ATTGCCAAAGAGGAGCAGCGCAAGGCTTGGAAGATGCAAGGTGTTGGAGAGAAGTTTTCAACTTGGGAAC
CAACTAAACGGGAGCTGGAACTGCTGAAGCATAACCCAAAGAGGCGGAAGATCACCTCCAATTGTACCAT
AGGTCTGCGTGGACTGATCAACCTGGGGAACACGTGTTTCATGAACTGCATCGTGCAGGCGC
nt 343 - nt 754 of NM_001004143.3
Notes:The Usp22 probe template used in this study by Lee et al., 2006 [PMID:16378762] is described as follows: " To generate antisense probe (194-605 bp), Usp22 was linearized using BamHI and transcribed using SP6 RNA polymerases." Editors Note: Elsewhere in the manuscript the authors describe cloning of a Usp22 cDNA by PCR using (Usp22)/F (5'-CGGGGATCCCCCCCCATG-3') and (Usp22)/R (5'-CTGACCAGCTCGAGATAAGGCTACTC-3') as primers and KIAA 1063 clone (AB028936) obtained from Kazusa DNA Research Institute, Japan, as template. This amplifies the ORF region of Usp22 (corresponding to nt149-1772 of the Usp22 mRNA RefSeq NM_001004143.3). It is assumed that the nucleotide numbering used by the authors refers to their cloned fragment. BamHI cuts outwith the cloned fragment.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Lee HJ; Kim MS; Shin JM; Park TJ; Chung HM; Baek KH, 2006 [PMID:16378762] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2005.07.007] [ PMID:16378762] Lee HJ, Kim MS, Shin JM, Park TJ, Chung HM, Baek KH 2006 The expression patterns of deubiquitinating enzymes, USP22 and Usp22. Gene Expr Patterns (6):277-84
Links:MGI:3621554 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI