Type: | in situ hybridisation probe |
Identifier: | MGI:3621551 |
Entity Detected: | Usp22, ubiquitin specific peptidase 22 ( MGI:2144157) |
Sequence: | sense strand is shown
>MGI:3621551
AAGGCAAAGTCCTGTGTCTGCCATGTCTGCGGCATCCACCTGAACCGGCTGCACTCTTGCCTCTACTGTG
TCTTCTTTGGCTGTTTCACGAAGAAGCACATCCATGACCATGCCAAGTCAAAGCGACACAACCTGGCCAT
CGACCTGATGTACGGAGGTATTTACTGCTTCTTGTGTCAGGACTACATCTATGACAAAGACATAGAAATC
ATTGCCAAAGAGGAGCAGCGCAAGGCTTGGAAGATGCAAGGTGTTGGAGAGAAGTTTTCAACTTGGGAAC
CAACTAAACGGGAGCTGGAACTGCTGAAGCATAACCCAAAGAGGCGGAAGATCACCTCCAATTGTACCAT
AGGTCTGCGTGGACTGATCAACCTGGGGAACACGTGTTTCATGAACTGCATCGTGCAGGCGC
|
| nt 343 - nt 754 of NM_001004143.3 |
Notes: | The Usp22 probe template used in this study by Lee et al., 2006 [PMID:16378762] is described as follows: " To generate antisense probe (194-605 bp), Usp22 was linearized using BamHI and transcribed using SP6 RNA polymerases."
Editors Note: Elsewhere in the manuscript the authors describe cloning of a Usp22 cDNA by PCR using (Usp22)/F (5'-CGGGGATCCCCCCCCATG-3') and (Usp22)/R (5'-CTGACCAGCTCGAGATAAGGCTACTC-3') as primers and KIAA 1063 clone (AB028936) obtained from Kazusa DNA Research Institute, Japan, as template. This amplifies the ORF region of Usp22 (corresponding to nt149-1772 of the Usp22 mRNA RefSeq NM_001004143.3). It is assumed that the nucleotide numbering used by the authors refers to their cloned fragment. BamHI cuts outwith the cloned fragment. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |