Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4393

Lrrtm1 leucine rich repeat transmembrane neuronal 1 ( MGI:2389173)
TS17 (10.0 dpc)
in situ hybridisation

Data Images
EMAGE:4393 EMAGE:4393 EMAGE:4393 EMAGE:4393 EMAGE:4393
Fig1J. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig1K. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig1L. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig1M. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig1N. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007
EMAGE:4393 EMAGE:4393
Fig1O. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig1P. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: arrowhead - sharp boundary (of expression) present in the midbrain; aer - apical ectodermal ridge; nt - neural tube; ov - otic vesicle; fp - floor plate; asterisk - non-specific signal in otic vesicle. Fig1K is a view from above. Fig1L is a higher magnification of the otic vesicle showing staining in the endolymphatic appendage masked by the non-specific signal in Fig1J (asterisk). Figs1M,O,P are sectons taken from the approximate regions indicated by white lines in Fig1J and 1L.
Expression Pattern Description
Spatial Annotation:
EMAGE:4393Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4393_wholemount_strong_3D_1.wlz
4393_wholemount_moderate_3D_1.wlz
4393_wholemount_weak_3D_1.wlz
4393_wholemount_possible_3D_1.wlz
4393_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4393_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
forelimb bud apical ectodermal ridge
detected detected
hindlimb bud apical ectodermal ridge
detected detected
forebrain
detected detected
midbrain
detected detected
endolymphatic appendage
detected detected
Expression is in the endolymphatic diverticular appendage of the otic vesicle
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3694266
Entity Detected:Lrrtm1, leucine rich repeat transmembrane neuronal 1 ( MGI:2389173)
Sequence:sense strand is shown

>MGI:3694266
CTGCAGCCCCGGAGCGCAGCAGCAAAGTGAGACATTGTGCGTCTGCCAGATCCTCGGGCCGCGGAGCAGG
GCTGCCTCGGGAAACACAGAGGGGTCTTCTCTCGCCCTGCATATAATTAGCCTACACACAAAGGGAGCAG
CTGAATGGAGGTTGTCACTCGCTGGAAAAGGATTTCTGACCCAGCGCTTCCAATGGACATTCTCCAGTCT
CTCTGGAAAGATTCTCGCTAATGGATTTCCTGCTACTCGGCCTCTGTCTACACTGGCTGCTGAGGAGGCC
CTCGGGGGTGGTCTTGTGTCTGCTGGGGGCCTGCTTTCAGATGCTGCCCGCCGCCCCCAGCGGATGCCCG
GGGCAGTGTCGGTGCGAGGGGCGGCTGCTGTACTGCGAGGCGCTCAACCTAACCGAGGCGCCCCATAACC
TGTCCGGCCTGCTGGGCTTGTCTTTGCGCTACAACAGCCTCTCGGAGCTGCGCGCCGGCCAGTTCACAGG
GTTAATGCAGCTCACGTGGCTGTATTTGGATCACAATCACATCTGCTCGGTGCAGGGGGACGCCTTTCAG
AAACTGCGCCGAGTTAAGGAACTCACGCTGAGTTCCAACCAGATCACTGAACTGGCCAACACCACCTTCC
GGCCCATGCCCAACCTGCGCAGCGTGGACCTGTCCTATAACAAGCTGCAG
nt 218 - nt 897 of BC027803.1
Notes:The Lrrtm1 probe used in this study by Haines & Rigby, 2007 [PMID:16860615] is described as follows: "A LRRTM1 cDNA was obtained from IMAGE clone 5321979 digested with PstI. The fragment from 218 to 897 base pairs was cloned into PstI digested pBluescript II KS. An antisense probe was generated by digesting with BamHI and transcribing with T3 polymerase (Roche)."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.0 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:alkaline phosphatase + NBT/Red Phos
General Information
Authors:Haines BP & Rigby PW, 2007 [PMID:16860615] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2006.05.004] [ PMID:16860615] Haines BP, Rigby PW 2007 Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Gene Expr Patterns (7):23-9
Links:MGI:3694270 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI