Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4394

Lrrtm2 leucine rich repeat transmembrane neuronal 2 ( MGI:2389174)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4394 EMAGE:4394 EMAGE:4394
Fig2A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig2B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007 Fig2C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2006.05.004] Gene Expr Patterns 7: 23-9, Haines BP; Rigby PW, Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Copyright 2007

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Fig2A - neural tube (arrowhead). Sections (Fig2B and 2C) show that staining is localized to the motor horn (arrowheads) throughout the neural tube (nt). The approximate plane of sections B and C is shown with lower case letters (Fig2A). fp indicates the floor plate. Non-specific staining in the cloaca is shown (asterisk in Fig2A).
Expression Pattern Description
Spatial Annotation:
EMAGE:4394Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4394_wholemount_strong_3D_1.wlz
4394_wholemount_possible_3D_1.wlz
4394_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4394_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
neural tube
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3694250
Entity Detected:Lrrtm2, leucine rich repeat transmembrane neuronal 2 ( MGI:2389174)
Sequence:sense strand is shown

>MGI:3694250
GTCAGCAGCTGCCATACAAAGAATGTGAAGTATAATATCTACCCATCATCAAAAATCACATCAGATAAGT
AACCTATTTTACATAGTAGGGGCTAAATACATATCTAATTTTTACCAATGGTGACATTAAGCCTAATTTT
CCAAACCAAGTGGAGACTTGAGTTTTTGAAGTGTTAAAGTATTTTTAATTTTTTAATGAAAACATATTTT
AAGTGTTAAGTGAAGCAATGCTCACATTAATTTGCACTCTTGTTGGAAAGTCTAAATGCTTACTTCAATA
TAAAACATTTCATGTATGTAATTATATACAACTGTATGTAAACATTTGCGCTAAGGTCTCCATATGTTTT
TTGGTTTTTTTTTTTACTGAAAACAGTTCCAAAAGATGCTACTAAACAAATATAGGTAGGGACAAAAACC
TGTTTGATTATTATTCTCCATCCTATGGACCACAACTGGCTTCCTACTTAAGAAGGAGACAGCAAAGTTC
TCTTGTAAGATAATGTGGTATTTACTCAAATTATAATTTACTGCCAGTATAAGAAGTAGACTTACATGTG
TGCTTAAGACTGGTAAATATTAAACGTTATTCTTTCAGTTTGGCTTGGCT
nt 81037 - nt 81646 of AC121874.2
Notes:The Lrrtm2 probe used in this study by Haines & Rigby, 2007 [PMID:16860615] is a mixture of two probes, the preparation of which is described as follows: "Two LRRTM2 probes were obtained by PCR using primers 5'-GTCAGCAGCTGCCATACAAA and 5'-AGCCAAGCCAAACTGAAAGA (LRRTM2 RT1), and 5'-AAGCTGCAGACCTTGCATTT and 5'-TGGCAGTGACAGTGGTTGAT (LRRTM2 RT2) from the BAC RP24-124K16 which contains the LRRTM2 gene. The PCR products were cloned into EcoRV digested pBluescript II KS yielding the plasmids LRRTM2 RT1 and LRRTM2 RT2. Antisense riboprobes were generated by digesting LRRTM2 RT1 with EcoRI and transcribing with T3 RNA polymerase and digesting LRRTM2 RT2 with SalI and transcribing with T7 RNA polymerase. Both probes were used in a single in situ hybridisation." Editors Note: the nucleotide sequences of each probe fragment, relative to the BAC RP24-124K16 sequence (AC121874.2) are - LRRTM2 RT1: nt 81037-81646 and LRRTM2 RT2: nt 79995-80631. EcoRI and SalI cut externally to these fragments.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:alkaline phosphatase + NBT/Red Phos
General Information
Authors:Haines BP & Rigby PW, 2007 [PMID:16860615] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2006.05.004] [ PMID:16860615] Haines BP, Rigby PW 2007 Developmentally regulated expression of the LRRTM gene family during mid-gestation mouse embryogenesis. Gene Expr Patterns (7):23-9
Links:MGI:3694267 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI