Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4407

Itga4 integrin alpha 4 ( MGI:96603)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4407
Fig1t. Copyright: This image is from [doi:10.1002/dvdy.20136] Bajanca F; Luz M; Duxson MJ; Thorsteinsdottir S, "Integrins in the mouse myotome: developmental changes and differences between the epaxial and hypaxial lineage." Dev Dyn 2004 Oct;231(2):402-15, and is displayed with the permission of Wiley-Liss, Inc. who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: caudal somites (black arrows), interlimb level hypaxial myotomes (arrowheads), epaxial dermomyotomal lips (white arrows).
Expression Pattern Description
Spatial Annotation:
EMAGE:4407Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4407_wholemount_strong_3D_1.wlz
4407_wholemount_moderate_3D_1.wlz
4407_wholemount_weak_3D_1.wlz
4407_wholemount_possible_3D_1.wlz
4407_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4407_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk somite
strong strong
regionalExpression is evident in caudal somites, in interlimb level hypaxial myotomes, in intercalated myotome, and, rostrally, in epaxial dermomyotomal lips. Rostrally, expression is very strong in the dorsomedial lip of the dermomyotome.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Itga4 cloneA
Entity Detected:Itga4, integrin alpha 4 ( MGI:96603)
Sequence:sense strand is shown

>Itga4 cloneA
CAACAGCAAAAGCAATGATGACTGAAGACTTCTACACTGAGAGAACTGAAAAACTCAGGTTAGGAAAAAG
AAATCCTGTTCAGAAGACCCGTCAGAATTTCTTCTTTTTTTCCATGTGCTTATGATTTTGTGACATACTC
TTAGTGCAGGGGAAATCTTCAAGAAAGAAGCTACCCAAAGGTGGCTTGTCAGCTTCGGTGGATGAGTGAA
GCAAAACACTGAAGCTCTGGATGTACCGGAGAGGTGACCTGTTTAAGACAACTTAAAGCTAGAGAGAATC
CAGACTCAGCAGGGCCGACTTAAAGGGAATGATTTTTCAACATCACTGATGAAGTGGCCATCTCAGTGAA
ATGGATGCCATGATGTGGAAACTTGTTGGCTTCAAATACTTTTGATTTATCTTCAAACTATGATCATGAT
CTTTG
nt 3233 - nt 3657 of X53176.1
Notes:The Itga4 (integrin subunit a4) probe used in this study by Bajanca et al., 2004 [PMID:15366018] is described as a gift from JT Yang. Editors note: This probe is described in further detail by Pinco, Liu & Yang, 2002 [PMID:12221126] , as corresponding "to a 425bp HincII(3281)/EcoRI(3706) 3' fragment of pZ5.6 (Neuhaus et al., 1991 [PMID:1840602] )." Neuhaus submitted the mouse integrin alpha-4 mRNA sequence X53176.1 to Genbank to accompany this publication and digestion of this sequence with HincII/EcoRI identifies a fragment of the same size within the 3' UTR as described by Pinco et al.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Bajanca F; Luz M; Duxson MJ; Thorsteinsdottir S, 2004 [PMID:15366018] , Indexed and Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1002/dvdy.20136] [ PMID:15366018] Bajanca F, Luz M, Duxson MJ, Thorsteinsdottir S 2004 Integrins in the mouse myotome: developmental changes and differences between the epaxial and hypaxial lineage. Dev Dyn (231):402-15
 [ doi:10.1091/mbc.02-05-0086] [ PMID:12221126] Pinco KA, He W, Yang JT 2002 alpha4beta1 integrin regulates lamellipodia protrusion via a focal complex/focal adhesion-independent mechanism. Mol Biol Cell (13):3203-17
 [ doi:10.1083/jcb.115.4.1149] [ PMID:1840602] Neuhaus H, Hu MC, Hemler ME, Takada Y, Holzmann B, Weissman IL 1991 Cloning and expression of cDNAs for the alpha subunit of the murine lymphocyte-Peyer's patch adhesion molecule. J Cell Biol (115):1149-58
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE