Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4408

Itga4 integrin alpha 4 ( MGI:96603)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4408
Fig1k. Copyright: This image is from [doi:10.1002/dvdy.20136] Bajanca F; Luz M; Duxson MJ; Thorsteinsdottir S, "Integrins in the mouse myotome: developmental changes and differences between the epaxial and hypaxial lineage." Dev Dyn 2004 Oct;231(2):402-15, and is displayed with the permission of Wiley-Liss, Inc. who owns the Copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Yellow arrow = the first clearly epithelial somite, black arrow = somite IV.
Expression Pattern Description
Spatial Annotation:
EMAGE:4408Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4408_wholemount_strong_3D_1.wlz
4408_wholemount_moderate_3D_1.wlz
4408_wholemount_weak_3D_1.wlz
4408_wholemount_possible_3D_1.wlz
4408_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4408_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk somite
detected detected
regionalItga4 expression is detected more caudally than Mlc1a at this stage (i.e. at somite IV).
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Itga4 cloneA
Entity Detected:Itga4, integrin alpha 4 ( MGI:96603)
Sequence:sense strand is shown

>Itga4 cloneA
CAACAGCAAAAGCAATGATGACTGAAGACTTCTACACTGAGAGAACTGAAAAACTCAGGTTAGGAAAAAG
AAATCCTGTTCAGAAGACCCGTCAGAATTTCTTCTTTTTTTCCATGTGCTTATGATTTTGTGACATACTC
TTAGTGCAGGGGAAATCTTCAAGAAAGAAGCTACCCAAAGGTGGCTTGTCAGCTTCGGTGGATGAGTGAA
GCAAAACACTGAAGCTCTGGATGTACCGGAGAGGTGACCTGTTTAAGACAACTTAAAGCTAGAGAGAATC
CAGACTCAGCAGGGCCGACTTAAAGGGAATGATTTTTCAACATCACTGATGAAGTGGCCATCTCAGTGAA
ATGGATGCCATGATGTGGAAACTTGTTGGCTTCAAATACTTTTGATTTATCTTCAAACTATGATCATGAT
CTTTG
nt 3233 - nt 3657 of X53176.1
Notes:The Itga4 (integrin subunit a4) probe used in this study by Bajanca et al., 2004 [PMID:15366018] is described as a gift from JT Yang. Editors note: This probe is described in further detail by Pinco, Liu & Yang, 2002 [PMID:12221126] , as corresponding "to a 425bp HincII(3281)/EcoRI(3706) 3' fragment of pZ5.6 (Neuhaus et al., 1991 [PMID:1840602] )." Neuhaus submitted the mouse integrin alpha-4 mRNA sequence X53176.1 to Genbank to accompany this publication and digestion of this sequence with HincII/EcoRI identifies a fragment of the same size within the 3' UTR as described by Pinco et al.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Bajanca F; Luz M; Duxson MJ; Thorsteinsdottir S, 2004 [PMID:15366018] , Indexed and Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.20136] [ PMID:15366018] Bajanca F, Luz M, Duxson MJ, Thorsteinsdottir S 2004 Integrins in the mouse myotome: developmental changes and differences between the epaxial and hypaxial lineage. Dev Dyn (231):402-15
 [ doi:10.1091/mbc.02-05-0086] [ PMID:12221126] Pinco KA, He W, Yang JT 2002 alpha4beta1 integrin regulates lamellipodia protrusion via a focal complex/focal adhesion-independent mechanism. Mol Biol Cell (13):3203-17
 [ doi:10.1083/jcb.115.4.1149] [ PMID:1840602] Neuhaus H, Hu MC, Hemler ME, Takada Y, Holzmann B, Weissman IL 1991 Cloning and expression of cDNAs for the alpha subunit of the murine lymphocyte-Peyer's patch adhesion molecule. J Cell Biol (115):1149-58
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE