Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4414

Fzd5 frizzled homolog 5 (Drosophila) ( MGI:108571)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4414
Figure1 Fz5-D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(99)00205-1] Mech Dev 89: 173-177, Borello U, Buffa V, Sonnino C, Melchionna R, Vivarelli E, Cossu G, Wnt receptors and Wnt inhibitors are expressed in gradients in the developing telencephalon. Copyright 1999.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:4414Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4414_wholemount_strong_3D_1.wlz
4414_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4414_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
eye
detected detected
regionalExpressed in the optic vesicle, specifically to the sensory layer of the retina
lung
weak weak
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Fzd5 probeB
Entity Detected:Fzd5, frizzled homolog 5 (Drosophila) ( MGI:108571)
Sequence:sense strand is shown

>Fzd5 probeB
AGTGCCCAACTGCGCGGTGCCCTGCTACCAGCCGTCCTTCAGCCCGGACGAGCGCACGTTCGCCACCTTC
TGGATTGGCCTGTGGTCTGTGCTGTGCTTCATCTCCACGTCCACCACCGTTGCCACCTTCCTCATTGACA
TGGAACGATTCCGCTACCCTGAGCGCCCCATCATCTTCTTGTCTGCGTGCTACCTGTGTGTGTCACTGGG
ATTCTTGGTGCGCCTGGTAG
nt 13 - nt 242 of AF005203.1
Notes:The Fzd5 probe used in this study by Borello et al., 1999 [PMID:10559494] was "PCR-cloned from genebank sequence Fz5 AF005203 using the following primers: frw.-AGTGCCCAACTGCGCGGT, rev.-CTACCAGGCGCACCAAGA".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Borello U; Buffa V; Sonnino C; Melchionna R; Vivarelli E; Cossu G, 1999 [PMID:10559494] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(99)00205-1] [ PMID:10559494] Borello U, Buffa V, Sonnino C, Melchionna R, Vivarelli E, Cossu G 1999 Differential expression of the Wnt putative receptors Frizzled during mouse somitogenesis. Mech Dev (89):173-7
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE