Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4540

Mdm2 transformed mouse 3T3 cell double minute 2 ( MGI:96952)
TS14 (14-16 Somite no.)
in situ hybridisation

Data Images
EMAGE:4540 EMAGE:4540 EMAGE:4540 EMAGE:4540 EMAGE:4540
Fig 1I Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00339-2] Mech Dev 103: 163-165, Daujat S; Neel H; Piette J, Preferential expression of Mdm2 oncogene during the development of neural crest and its derivatives in mouse early embryogenesis. Copyright 2001 Fig 1K Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00339-2] Mech Dev 103: 163-165, Daujat S; Neel H; Piette J, Preferential expression of Mdm2 oncogene during the development of neural crest and its derivatives in mouse early embryogenesis. Copyright 2001 Fig 2A Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00339-2] Mech Dev 103: 163-165, Daujat S; Neel H; Piette J, Preferential expression of Mdm2 oncogene during the development of neural crest and its derivatives in mouse early embryogenesis. Copyright 2001 Fig 2B Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00339-2] Mech Dev 103: 163-165, Daujat S; Neel H; Piette J, Preferential expression of Mdm2 oncogene during the development of neural crest and its derivatives in mouse early embryogenesis. Copyright 2001 Fig 2C Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00339-2] Mech Dev 103: 163-165, Daujat S; Neel H; Piette J, Preferential expression of Mdm2 oncogene during the development of neural crest and its derivatives in mouse early embryogenesis. Copyright 2001

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
1I shows a specimen stained with antisense probe and 1K, a similarly staged embryo stained with a sense probe. The three sections 2A, 2B and 2C are taken from the embryo shown in 1I: rostral to caudal cryosections (A-C). Image annotations: 1,2,3 - streams of neural crest cells extending towards the first, second and third branchial arches (labeled 1-3, respectively); ec, ectoderm; fg, foregut; me, mesenchyme; nf, neural fold.
Expression Pattern Description
Spatial Annotation:
EMAGE:4540Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4540_wholemount_moderate_3D_1.wlz
4540_wholemount_weak_3D_1.wlz
4540_wholemount_possible_3D_1.wlz
4540_wholemount_notDetected_3D_1.wlz
4540_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4540_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch mesenchyme derived from neural crest
detected detected
Crest cells migrating into 1st branchial arch are most likely derived from rhombomere 2
2nd branchial arch mesenchyme derived from neural crest
detected detected
Crest cells migrating into 2nd branchial arch are most likely derived from rhombomere 4
3rd branchial arch mesenchyme derived from neural crest
detected detected
Crest cells migrating into 3rd branchial arch are most likely derived from rhombomere 6
rhombomere 02
detected detected
regionalCrest cells migrating into 1st branchial arch are most likely derived from rhombomere 2
rhombomere 04
detected detected
regionalCrest cells migrating into 2nd branchial arch are most likely derived from rhombomere 4
rhombomere 06
detected detected
regionalCrest cells migrating into 3rd branchial arch are most likely derived from rhombomere 6
head mesenchyme derived from neural crest
detected detected
Expression is detected in craniofacial mesenchyme
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Mdm2 probeA
Entity Detected:Mdm2, transformed mouse 3T3 cell double minute 2 ( MGI:96952)
Sequence:sense strand is shown

>Mdm2 probeA
ATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTAACCACCTCACAGATTCCAGCTTCGGAAC
AAGAGACCCTGGTTAGACCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGACAC
TTATACTATGAAAGAGGTTCTTTTTTATCTTGGCCAGTATATTATGACTAAACGATTATATGATGAGAAG
CAACAACATATTGTATATTGTTCAAATGATCTTCTAGGAGATTTGTTTGGCGTGCCAAGCTTCTCTGTGA
AAGAGCACAGGAAAATATATACCATGATCTACAGGAACTTGGTAGTAGTCAATCAGCAGGAATCATCGGA
CTCAGGTACATCTGTGAGTGAGAACAGGTGTCACCTTGAAGGTGGGAGTGATCAAAAGGACCTTGTACAA
GAGCTTCAGGAAGAGAAACCTTCATCTTCACATTTGGTTTCTAGACCATCTACCTCATCTAGAAGGAGAG
CAATTAGTGAGACAGAAGAAAATTCAGATGAATTATCTGGTGAACGACAAAGAAAACGCCACAAATCTGA
TAGTATTTCCCTTTCCTTTGATGAAAGCCTGGCTCTGTGTGTAATAAGGGAGATATGTTGTGAAAGAAGC
AGTAGCAGTGAATCTACAGGGACGCCATCGAATCCGGATCTTGATGCTGGTGTAAGTGAACATTCAGGTG
ATTGGTTGGATCAGGATTCAGTTTCAGATCAGTTTAGTGTAGAATTTGAAGTTGAATCTCTCGACTCAGA
AGATTATAGCCTTAGTGAAGAAGGACAAGAACTCTCAGATGAAGATGATGAGGTATATCAAGTTACTGTG
TATCAGGCAGGGGAGAGTGATACAGATTCATTTGAAGAAGATCCTGAAATTTCCTTAGCTGACTATTGGA
AATGCACTTCATGCAATGAAATGAATCCCCCCCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGA
GAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCA
ACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCAT
GTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCC
ATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAA
GACAAAGAAGAGAGTGTGGAATCTAGTTTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAAGGTC
GACCTAAAAATGGTTGCATTGTCCATGGCAAAACAGGACATCTTATGGCCTGCTTTACATGTGCAAAGAA
GCTAAAGAAAAGGAATAAGCCCTGCCCAGTATGTAGACAACCAATTCAAATGATTGTGCTAACTTATTTC
CCCTAG
nt 1 - nt 1476 of A61359.1
Notes:The Mdm2 probe used in this study by Daujat et al., 2001 [PMID:11335127] is described as such: "riboprobes correspond to the complete 1.5 kb Mdm2 cDNA fragment; they were isolated from plasmid pXJ-Mdm2 (gift from B. Wasylyk) and cloned in pBluescript KS+". Editors note: searching of GenBank finds a 1476 bp Mdm2 fragment from B.Wasylyk which covers the entire ORF and is assumed to correspond to this clone.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:involves: B6D2
Age:14-16 Somite no.
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Daujat S, Neel H, Piette J. 2001 [PMID:11335127] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00339-2] [ PMID:11335127] Daujat S, Neel H, Piette J 2001 Preferential expression of Mdm2 oncogene during the development of neural crest and its derivatives in mouse early embryogenesis. Mech Dev (103):163-5
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE