Type: | in situ hybridisation probe |
Identifier: | Mpp4 probeA |
Entity Detected: | Mpp4, membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) ( MGI:2386681) |
Sequence: | sense strand is shown
>Mpp4 probeA
GATAGGGAGGATGATACAGTCTGACAGAGGAGCAGAGCTGACCAATGAGGACAGAGCTCTTCCCACGCCA
CCTGATCCTGAGAATGGTCTCTCTGGGATCCTGAGGCTCCTACTGCAGGAACTGAGCCTTTTCTACAGCC
GAGATGTGAATGGTCTGTGTCTCTTATATGACCTCCTCCATTCACCATGGCTGCAGGCTCTGCTCAAGGT
CTACGACTGCCTCCAGAGGTTTAAAGAGAAGAAGCTAGTTCCTGATACAACTCATGCACAGATCTTAGCC
TGTGAGGTCTTGGAGCTGTTACCCAAA
|
| nt 1 - nt 307 of AB059357.1 |
Notes: | The Mpp6 (mDLG6) probe used in this study by Inagaki et al., 2002 [PMID:12127943] was transcribed from one of two possible template clones which covered either the 5'UTR (nt 1-307) or the PDZ domain (nt 458-770). The results obtained with either probe were "not significantly different".
Editors Note: The nucleotide numbering refers to the sequence shown in Fig 1 therein and the corresponding GenBank sequence AB059357.1. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |