Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:461

Tfap2a transcription factor AP-2, alpha ( MGI:104671)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:461
Figure 4C of Kanzler et al., 2000 [PMID:10662648] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrowheads indicate neural crest migrating into the 1st branchial arch; Brackets indicate neural crest migrating into more posterior branchial arches.
Expression Pattern Description
Spatial Annotation:
EMAGE:461Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
461_wholemount_strong_3D_1.wlz
461_wholemount_moderate_3D_1.wlz
461_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:461_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
3rd branchial arch mesenchyme derived from neural crest
detected detected
1st branchial arch maxillary component mesenchyme derived from neural crest
detected detected
2nd branchial arch mesenchyme derived from neural crest
detected detected
1st branchial arch mandibular component mesenchyme derived from neural crest
detected detected
head mesenchyme derived from neural crest
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:9015
Entity Detected:Tfap2a, transcription factor AP-2, alpha ( MGI:104671)
Sequence:sense strand is shown

>MGI:9015
AGATCTTTAAGAGAAAAACTGGACAAGATAGGATTGAATCTGCCAGCAGGGAGACGTAAAGCTGCCAACG
TTACTCTCCTCACGTCACTAGTGGAAGGAGAAGCCGTCCACCTAGCCAGGGACTTTGGGTACGTGTGCGA
AACTGAATTTCCTGCCAAAGCAGTAGCAGAATTTCTCAACCGACAACATTCCGATCCCAATGAGCAAGTG
GCAAGAAAAAACATGCTCCTGGCCACAAAACAG
nt 13 - nt 255 of X57012.1
Notes:The Tcfap2a (AP2) probe used in this study by Kanzler et al., 2000 [PMID:10662648] was previously described by Mitchell et al., 1991 [PMID:1989904] as " the 240-bp BglII fragment of mouse AP-2".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase
General Information
Authors:Kanzler et al., 2000 [PMID:10662648] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10662648] Kanzler B, Foreman RK, Labosky PA, Mallo M 2000 BMP signaling is essential for development of skeletogenic and neurogenic cranial neural crest. Development (127):1095-104
 [ doi:10.1101/gad.5.1.105] [ PMID:1989904] Mitchell PJ, Timmons PM, Hebert JM, Rigby PW, Tjian R 1991 Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev (5):105-19
Links:MGI:1352810 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE