Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4653

Arid3b AT rich interactive domain 3B (BRIGHT-like) ( MGI:1930768)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4653 EMAGE:4653 EMAGE:4653 EMAGE:4653 EMAGE:4653
Fig2D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2005.12.016] Dev Biol 293: 25-37, Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, Microarray analysis of PDGFRalpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Copyright 2005. Fig2J. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2005.12.016] Dev Biol 293: 25-37, Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, Microarray analysis of PDGFRalpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Copyright 2005. Fig2K. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2005.12.016] Dev Biol 293: 25-37, Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, Microarray analysis of PDGFRalpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Copyright 2005. Fig2L. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2005.12.016] Dev Biol 293: 25-37, Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, Microarray analysis of PDGFRalpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Copyright 2005. Fig2M. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2005.12.016] Dev Biol 293: 25-37, Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, Microarray analysis of PDGFRalpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Copyright 2005.
EMAGE:4653
Fig2N. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2005.12.016] Dev Biol 293: 25-37, Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, Microarray analysis of PDGFRalpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Copyright 2005.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: J-N on wholemount indicate the levels at which the appropriate sections were taken. (BA) branchial arch; (NT) neural tube; (OV) optic vesicle; (BP) branchial pouch; (OFT) outflow tract.
Expression Pattern Description
Spatial Annotation:
EMAGE:4653Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4653_wholemount_moderate.wlz
4653_wholemount_notDetected.wlz
4653_wholemount_strong.wlz
4653_wholemount_weak.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4653_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch
detected detected
regionalExpression is observed in the distal region of BA1.
2nd branchial arch
detected detected
regionalExpression is observed from the proximal to the distal region of the BA2.
trunk somite
detected detected
regionalExpression is observed in the precaudal somites.
tail unsegmented mesenchyme
detected detected
Expression is observed in the pre-somitic mesoderm.
neural tube
detected detected
regionalExpression is detected in the distal end of the neural tube.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Arid3b probeA
Entity Detected:Arid3b, AT rich interactive domain 3B (BRIGHT-like) ( MGI:1930768)
Sequence:sense strand is shown

>Arid3b probeA
ACAAGACTCCCTTCTGATCCTCAAACCTTGGCTTCCTGCCTGCCTATGTTGGCCAACTCTCCCAAGATAC
CACTGGTCCCTGGTCCCTAACGTCGTCTCGTGGGGCCATCTCAGCCCTACCAGCCCAAGACATGGTGATG
TCAGGCTCACTGAAATACCTCAGATTTGTAATTGTTGATATTTGATTCTTCAGGAAGTATTTGCATCTCT
GTAATATTTTTTTAATATGTGTTTTGCTGACTTTAATTTTTAAATTTTTATTGTTGCTGTTGTAGCACCA
AAGAAATGAAAGCAGATCACCCCAGCCAGGTGCAGTTTGCAGCCACCTCCCTCCACCCTGCCCATGCCCT
GGCCAGGGGGTGTAGCAGGTGGGGTGACTCAGGGATCATCACAGCAGGAGGATGGGGTGGAGGGACCCCT
GCTTGCTGGTGGCTCCTGAAACCACACTGGTTCTTTCCACCGCCCCTACCCCAGCTGTCAGGGTAGGGCA
GAGGATCTTTCTGCCTTTAGCACCCTCACCTTGGGGCAGAGGCAAATGGCTATGGGCCCTGCCTGAGGCT
GAGCTTCAGGAACAAGAGGATGCTAAGAGCTCTGTCTTCTGTTGGCATGCAGCTGGAACAGGCCACTGTG
GTAGAGAAAGGGTAGACCTTATCCAGGGCTCCAT
nt 2478 - nt 3141 of NM_019689.2
Notes:The Arid3b probe used in this study by Takebe et al., 2006 [PMID:16530748] was "amplified by PCR (primers: forward - ACAAGACTCCCTTCTGATCCTCA and reverse - ATGGAGCCCTGGATAAGGTCTA) using cDNA of day-4-differentiated ES cells."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Takebe A; Era T; Okada M; Martin Jakt L; Kuroda Y; Nishikawa S, 2006 [PMID:16530748] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.ydbio.2005.12.016] [ PMID:16530748] Takebe A, Era T, Okada M, Martin Jakt L, Kuroda Y, Nishikawa S 2006 Microarray analysis of PDGFR alpha+ populations in ES cell differentiation culture identifies genes involved in differentiation of mesoderm and mesenchyme including ARID3b that is essential for development of embryonic mesenchymal cells. Dev Biol (293):25-37
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE