Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4669

Axin1 axin 1 ( MGI:1096327)
TS14 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4669
Fig2B(E9.5). Copyright: Reprinted with permission from Cell Press from [doi:10.1016/S0092-8674(00)80324-4] [PMID:9230313] Cell 90: 181-192, Zeng L; Fagotto F; Zhang T; Hsu W; Vasicek TJ; Perry WL 3rd ; Lee JJ ; Tilghman SM ; Gumbiner BM ; Costantini F, The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Copyright 1997

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:4669Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4669_wholemount_moderate_3D_1.wlz
4669_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4669_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
homogeneousAxin mRNA is uniformly distributed throughout embryonic and extraembryonic tissues of the postimplantation embryo.
extraembryonic component
detected detected
homogeneousAxin mRNA is uniformly distributed throughout embryonic and extraembryonic tissues of the postimplantation embryo.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Axin1 probeA
Entity Detected:Axin1, axin 1 ( MGI:1096327)
Sequence:sense strand is shown

>Axin1 probeA
AAGCTTGAGCCCTGTGACTCAAATGAGGAAAAGAGGCTGAAGCTGGCAAGAGCCATCTACCGAAAGTACA
TCCTGGATAGCAATGGCATTGTGTCCAGACAAACCAAGCCAGCCACTAAGAGCTTCATAAAGGACTGTGT
CATGAAGCAGCAGATAGATCCTGCCATGTTTGACCAGGCACAGACAGAAATCCAGTCCACCATGGAGGAG
AATACCTACCCTTCCTTTCTTAAGTCTGACATTTATTTGGAGTACACAAGGACAGGCTCAGAGAGTCCGA
AGGTCTGCAGTGACCAGAGCT
nt 765 - nt 1065 of NM_009733.1
Notes:The Axin1 (Axin) probe used in this study by Zeng et al., 1997 [PMID:9230313] is described as follows, "an anti-sense probe was produced by T7 transcription of a HindIII-SacI fragment of mAxin cDNA (bp 765-1065, within exon 2) in pBluescript."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Zeng L; Fagotto F; Zhang T; Hsu W; Vasicek TJ; Perry WL 3rd; Lee JJ; Tilghman SM; Gumbiner BM; Costantini F, 1997 [PMID:9230313] , Indexed and Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0092-8674(00)80324-4] [ PMID:9230313] Zeng L, Fagotto F, Zhang T, Hsu W, Vasicek TJ, Perry WL, Lee JJ, Tilghman SM, Gumbiner BM, Costantini F 1997 The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Cell (90):181-92
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE