| Type: | in situ hybridisation probe |
| Identifier: | Bcr probeA |
| Entity Detected: | Bcr, breakpoint cluster region ( MGI:88141) |
| Notes: | The Bcr probe used in this study by Kaartinen et al., 2002 [PMID:11921339] is indicated as that described by Fioretos et al., 1995 [PMID:8581068] .
Editors Note: Fioretos et al., describe two Bcr in situ hybridisation probes as follows:
1. "A 400 bp fragment of mouse bcr was amplified by RT/PCR with the primers ALLE (Kawasaki et al., 1988 [PMID:3165197] ) and BEX3 (5' AACCCACTTTCTCATCTCCAG 3') as previously described (Heisterkamp et al., 1990 [PMID:2179728] ). The RT/PCR product was gel purified and digested with EcoRI and ClaI yielding a 251-bp fragment that was subcloned directionally into pSK (Stratagene). To obtain an antisense RNA probe, the construct was linearized with BamHI and transcribed in vitro using T7 polymerase".
2. "A second bcr antisense RNA probe was produced by digesting a 1.8-kb HindIII/EcoRI genomic fragment (Zhu et al., 1990 [PMID:2263470] ) cloned in pSK with NarI and transcription with T7 RNA polymerase".
Kaartinen et al. do not specify which of these probes they use. |
| Chemistry: | RNA |
| Strand: | antisense |