Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4698

Myl4 myosin, light polypeptide 4 ( MGI:97267)
TS16 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4698
Fig6B. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.2000.9748] [PMID:11884037] Dev Biol 223( 1): 169-180. Christine M. Liberatore, Robin D. Searcy-Schrick and Katherine E. Yutzey; Ventricular Expression of tbx5 Inhibits Normal Heart Chamber Development. Copyright 2000.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:4698Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4698_wholemount_notDetected_3D_1.wlz
4698_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4698_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
heart
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Myl4 probeA
Entity Detected:Myl4, myosin, light polypeptide 4 ( MGI:97267)
Sequence:sense strand is shown

>Myl4 probeA
CCTGCGTGAGAAAGCAAGAGATCCACAGCGGCTGTTACTGTTACGGAGTATTGGACTCACATGGCTTCTC
TGACCCACAACCTTCCCTGGAAATAAAGAGCCCCAGCTTGGAGTTTCATTAA
nt 138 - nt 259 of M20773.1
Notes:The Myl4 (MLC1Atrial) probe used in this study by Liberatore et al., 2000 [PMID:10864469] is indicated as that originally described by Lyons et al., 1990 [PMID:2277065] i.e. the "3' UTR of mouse MLC1Atrial mRNA 5'-TTAATGAAACTCCAAGCTGGGGCTCTTTATTTCCAGGGAAGGTTGTGGGTCAGAGAAGCCATGTGAGTCCAATACTCCGTAACAGTAACAGCCGCTGTGGATCTCTTGCTTTCTCACGCAGGCCAAGC-3' ".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:FVBN
Age:10.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Liberatore CM; Searcy-Schrick RD; Yutzey KE, 2000 [PMID:10864469] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.2000.9748] [ PMID:10864469] Liberatore CM, Searcy-Schrick RD, Yutzey KE 2000 Ventricular expression of tbx5 inhibits normal heart chamber development. Dev Biol (223):169-80
 [ doi:10.1083/jcb.111.6.2427] [ PMID:2277065] Lyons GE, Schiaffino S, Sassoon D, Barton P, Buckingham M 1990 Developmental regulation of myosin gene expression in mouse cardiac muscle. J Cell Biol (111):2427-36
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE