Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4701

Ndn necdin ( MGI:97290)
TS17 (10 dpc)
in situ hybridisation

Data Images
EMAGE:4701 EMAGE:4701 EMAGE:4701
Fig1A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00138-8] [PMID:14643685] Gene Expr Patterns 3(6): 761-5, Andrieu D; Watrin F; Niinobe M; Yoshikawa K; Muscatelli F; Fernandez PA, Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Copyright 2003. Fig1E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00138-8] [PMID:14643685] Gene Expr Patterns 3(6): 761-5, Andrieu D; Watrin F; Niinobe M; Yoshikawa K; Muscatelli F; Fernandez PA, Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Copyright 2003. Fig1G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00138-8] [PMID:14643685] Gene Expr Patterns 3(6): 761-5, Andrieu D; Watrin F; Niinobe M; Yoshikawa K; Muscatelli F; Fernandez PA, Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Copyright 2003.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: somitic series (sm); section plane of G is shown in A; fourth ventricle (IV). Editors Note: the structures labelled by the authors as mb (midbrain) and fb (forebrain) are in fact the hindbrain and midbrain respectively.
Expression Pattern Description
Spatial Annotation:
EMAGE:4701Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4701_wholemount_possible_3D_1.wlz
4701_wholemount_notDetected_3D_1.wlz
4701_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4701_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
neural tube
detected detected
1st branchial arch mandibular component
detected detected
trunk somite
detected detected
forelimb bud
detected detected
hindlimb bud
detected detected
hindbrain
detected detected
The authors specify that expression is found in midbrain (mb) however, the structure labelled in Fig 1E as mb, is in fact, the hindbrain (EMAGE editorial note).
midbrain
detected detected
The authors specify that expression is found in forebrain (fb) however, the structure labelled in Fig 1E as fb, is in fact, the midbrain (EMAGE editorial note).
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Ndn probeA
Entity Detected:Ndn, necdin ( MGI:97290)
Sequence:sense strand is shown

>Ndn probeA
TAAGTATTTGGTACTTTCACTTTTGTGCTTTCGTGCATTTTTGTACAAGAGATGTGCTGTGCTAAACTTG
TGAAATACATTGAGGTGTTCTGTATCTTGTTCCTTTGTATGGGACTGATGATCTGTATCGACAAAGAAGG
CCCTGGAGAGTTAGCAGGACTTAACAGCAACGCAGACCTGAGCAAGAGAAAGGTCAAGGCCTTTCTCCAT
ATGACTTCAACTGGCACAGGAAGCATCCATGTGGAATGGACTGATTTGAACTGGACTGTTCTCAGTGTAG
GCACTTAGCACCC
nt 1261 - nt 1553 of NM_010882.1
Notes:The Ndn probe used in this study by Andrieu et al., 2003 [PMID:14643685] "recognizes the 3'-UTR (from nucleotide 1174 after the ATG to nucleotide 1466) of the Necdin gene". Editors Note: Although the authors do not explicitly state it, it is assumed that the probe region also stops at 1466nt AFTER the ATG (i.e. at nt1553 in the mouse Ndn cDNA RefSeq NM_010882.1).
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Andrieu D; Watrin F; Niinobe M; Yoshikawa K; Muscatelli F; Fernandez PA, 2003 [PMID:14643685] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S1567-133X(03)00138-8] [ PMID:14643685] Andrieu D, Watrin F, Niinobe M, Yoshikawa K, Muscatelli F, Fernandez PA 2003 Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Gene Expr Patterns (3):761-5
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE