Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4707

Nf2 neurofibromatosis 2 ( MGI:97307)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4707 EMAGE:4707
Figure 5A. Copyright: This image is from [doi:10.1002/dvdy.20883] Akhmametyeva EM; Mihaylova MM; Luo H; Kharzai S; Welling DB; Chang LS, "Regulation of the Neurofibromatosis 2 gene promoter expression during embryonic development." Dev Dyn 2006 Aug 7;235(10):2771-2785. Reprinted with permission of Wiley-Liss Inc. [PMID:16894610] . Figure 5B. Copyright: This image is from [doi:10.1002/dvdy.20883] Akhmametyeva EM; Mihaylova MM; Luo H; Kharzai S; Welling DB; Chang LS, "Regulation of the Neurofibromatosis 2 gene promoter expression during embryonic development." Dev Dyn 2006 Aug 7;235(10):2771-2785. Reprinted with permission of Wiley-Liss Inc. [PMID:16894610] .

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
A - antisense, B - sense control. In A, arrows point to neural crest cell populated branchial arches and the asterisk marks the location of the paraaortic splanchnopleura.
Expression Pattern Description
Spatial Annotation:
EMAGE:4707Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4707_wholemount_possible_3D_1.wlz
4707_wholemount_notDetected_3D_1.wlz
4707_wholemount_strong_3D_1.wlz
4707_wholemount_moderate_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4707_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
Nf2 RNA expression was consistently detected throughout the entire embryo with the strongest expression in the developing brain and spinal cord.
future brain
strong strong
Nf2 RNA expression was strongest in the developing brain and spinal cord.
future spinal cord
strong strong
Nf2 RNA expression was strongest in the developing brain and spinal cord.
branchial arch
detected detected
regionalThe neural crest cell-populated branchial arches showed significant Nf2 RNA expression
mesenchyme derived from splanchnopleure
detected detected
regionalThe hematopoietic stem cell-containing paraaortic splanchnopleura also showed significant Nf2 RNA expression
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Nf2 probeA
Entity Detected:Nf2, neurofibromatosis 2 ( MGI:97307)
Sequence:sense strand is shown

>Nf2 probeA
GGCCTTGGACGTCCTACACAGCGAGAGCTCAGACAGAGGCGGCCCCAGCAGCAAGCATAATACCATTAAA
AAGCTCACTCTGCAGAGCGCCAAGTCCCGAGTGGCCTTCTTTGAAGAACTCTAGCAGGTGACCCGGCCAC
CTCCTGCCACATCTGCTGCTCCTGACACCAACAGGATGGGCCTGACCCAAAAGGAACCATCAGTAGAGGG
CTGGCTTGTTTGGGAACTCTTGAGTTGAGGGCCCCG
nt 2210 - nt 2455 of NM_010898.3
Notes:The Nf2 probe template used in this study by Akhmametyeva et al., 2006 [PMID:16894610] was "3U1" which was PCR amplified using the following primers: 3U1-F 5'-ggccttggacgtcctacagcg-3' and 3U1-R 5'-cggggccctcaactcaagagttcc-3'.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Akhmametyeva EM; Mihaylova MM; Luo H; Kharzai S; Welling DB; Chang LS, 2006 [PMID:16894610] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.20883] [ PMID:16894610] Akhmametyeva EM, Mihaylova MM, Luo H, Kharzai S, Welling DB, Chang LS 2006 Regulation of the neurofibromatosis 2 gene promoter expression during embryonic development. Dev Dyn (235):2771-85
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE