Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4724

Cbfb core binding factor beta ( MGI:99851)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:4724 EMAGE:4724
Fig2C(top). Copyright: Reprinted with permission from Cell Press from [doi:10.1016/S0092-8674(00)81389-6] Cell 87(4): 697-708, Wang Q; Stacy T; Miller JD; Lewis AF; Gu TL; Huang X; Bushweller JH; Bories JC; Alt FW; Ryan G; Liu PP; Wynshaw-Boris A; Binder M; Marin-Padilla M; Sharpe AH; Speck NA, The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo.Copyright 1996. [PMID:8929538] Fig2C(bottom). Copyright: Reprinted with permission from Cell Press from [doi:10.1016/S0092-8674(00)81389-6] Cell 87(4): 697-708, Wang Q; Stacy T; Miller JD; Lewis AF; Gu TL; Huang X; Bushweller JH; Bories JC; Alt FW; Ryan G; Liu PP; Wynshaw-Boris A; Binder M; Marin-Padilla M; Sharpe AH; Speck NA, The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo.Copyright 1996. [PMID:8929538]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: t - telencephalon; g - cranial ganglia; arrows - dorsal root ganglia. Fig2C(as) shows a wild-type embryo hybridized with the antisense probe, Fig2C(S) shows a wild-type embryo hybridized with the sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:4724Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4724_wholemount_moderate_3D_1.wlz
4724_wholemount_notDetected_3D_1.wlz
4724_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4724_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
telencephalon
detected detected
cranial ganglion
detected detected
dorsal root ganglion
detected detected
liver
weak weak
regionalThe fetal liver displayed a fine, streaky pattern of staining, suggesting a low level of expression in this tissue
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Cbfb probeA
Entity Detected:Cbfb, core binding factor beta ( MGI:99851)
Sequence:sense strand is shown

>Cbfb probeA
ATGCCGCGCGTCGTCCCGGACCAGAGGAGCAAGTTCGAGAACGAGGAGTTCTTCAGGAAGCTGAGCCGCG
AGTGCGAGATTAAGTACACGGGCTTCAGGGACCGGCCCCACGAGGAGCGCCAGACACGCTTCCAGAACGC
CTGCCGCGACGGTCGCTCGGAGATCGCTTTTGTGGCTACAGGAACCAATCTGTCTCTCCAGTTTTTTCCG
GCCAGCTGGCAGGGAGAACAGCGACAAACACCTAGCCGGGAATATGTCGACTTAGAGAGAGAAGCAGGCA
AGGTATACTTGAAGGCTCCCATGATTCTGAATGGAGTGTGTGTTATATGGAAGGGCTGGATTGATCTCCA
CAGATTGGATGGTATGGGTTGCCTGGAGTTTGATGAGGAGCGAGCCCAGCAGGAAGATGCATTAGCACAA
CAGGCCTTTGAAGAGGCTCGAAGAAGAACTCGAGAATTTGAGGATAGAGACAGGTCTCACCGGGAGGAAA
TGGAGGTGAGAGTTTCACAGCTGCTGGCAGTAACTGGCAAGAAGACAGCAAGACCCTAGTCCTGGTTCTA
ACTTAGGTGGCGGTGATGATCTCAAACTTCGTTAAGTGGAGCACAGCTTATGTGCCCCATCT
nt 82 - nt 703 of L03279.1
Notes:The Cbfb probe used in this study by Wang et al., 1996 [PMID:8929538] is described as follows: "A pBluescript SK+ (Stratagene)-based plasmid containing nucleotides 82-703 from the CBFb p21.5 cDNA (Wang et al., 1993 [PMID:8497254] ) was used to generate strand-specific RNA probes labeled with digoxigenin UTP." Editors Note: See Fig 4a of Wang (and L03279.1) for the CBFb p21.5 cDNA sequence referred to.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Wang Q; Stacy T; Miller JD; Lewis AF; Gu TL; Huang X; Bushweller JH; Bories JC; Alt FW; Ryan G; Liu PP; Wynshaw-Boris A; Binder M; Marin-Padilla M; Sharpe AH; Speck NA, 1996 [PMID:8929538] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0092-8674(00)81389-6] [ PMID:8929538] Wang Q, Stacy T, Miller JD, Lewis AF, Gu TL, Huang X, Bushweller JH, Bories JC, Alt FW, Ryan G, Liu PP, Wynshaw-Boris A, Binder M, Marín-Padilla M, Sharpe AH, Speck NA 1996 The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell (87):697-708
 [ PMID:8497254] Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR, Speck NA 1993 Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol Cell Biol (13):3324-39
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE