Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4738

Cdc45 cell division cycle 45 homolog (S. cerevisiae) ( MGI:1338073)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4738 EMAGE:4738 EMAGE:4738 EMAGE:4738
Fig1H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00489-0] Mech Dev 108(1-2): 81-92, Kunte A; Ivey K; Yamagishi C; Garg V; Yamagishi H; Srivastava D, A common cis-acting sequence in the DiGeorge critical region regulates bi-directional transcription of UFD1L and CDC45L. Copyright 2001. [PMID:11578863] Fig1E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00489-0] Mech Dev 108(1-2): 81-92, Kunte A; Ivey K; Yamagishi C; Garg V; Yamagishi H; Srivastava D, A common cis-acting sequence in the DiGeorge critical region regulates bi-directional transcription of UFD1L and CDC45L. Copyright 2001. [PMID:11578863] Fig1F. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00489-0] Mech Dev 108(1-2): 81-92, Kunte A; Ivey K; Yamagishi C; Garg V; Yamagishi H; Srivastava D, A common cis-acting sequence in the DiGeorge critical region regulates bi-directional transcription of UFD1L and CDC45L. Copyright 2001. [PMID:11578863] Fig1G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00489-0] Mech Dev 108(1-2): 81-92, Kunte A; Ivey K; Yamagishi C; Garg V; Yamagishi H; Srivastava D, A common cis-acting sequence in the DiGeorge critical region regulates bi-directional transcription of UFD1L and CDC45L. Copyright 2001. [PMID:11578863]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: pa - pharyngeal arches; aa - aortic arch artery; nt - neural tube; ht - heart; h - head; lb - limb bud. Sections E,F,G are from a similarly staged embryo to the wholemount stained embryo in H. E - brightfield; F - radioactive in situ, hybridised with antisense Cdc45l probe; G - radioactive in situ, hybridised with sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:4738Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4738_wholemount_moderate_3D_1.wlz
4738_wholemount_weak_3D_1.wlz
4738_wholemount_notDetected_3D_1.wlz
4738_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4738_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
embryo
weak weak
homogeneousUbiquitous low level expression with the highest levels seen in the pharyngeal arches. Lower levels of expression were detected in other areas such as the heart mesenchyme and in the cleft between the second and third pharyngeal arches.
branchial arch
detected detected
highest levels of expression are seen in the neural crest-derived pharyngeal arches, with lower levels in the cleft between the second and third pharyngeal arches
limb
detected detected
heart
weak weak
regionalLow level expression was detected in heart mesenchyme.
arterial system
detected detected
Expression in the aortic arch artery is enhanced.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Cdc45l probeA
Entity Detected:Cdc45, cell division cycle 45 homolog (S. cerevisiae) ( MGI:1338073)
Sequence:sense strand is shown

>Cdc45l probeA
ACCACTTCATCCAGGCTCTCGATAGCCTCTCCAGGAGTAACCTGGACAAGCTATACCTTGGTCTAGAGCT
CGCCAAGAAGCACCTCCAAGCCACACAACAGACCATCGCCAGCTGTCTCTGTACCAACCTCGTCACTTCC
CAGGGCCCTTTTCTCTACTGCTCACTCATGGAGGGCACTCCAGATGTCACCCTGTTTTCCAAGCCAGCAT
CCTTGAGTCTGCTCAGCAGACATCTGCTCAAGTCCTTTGTGTACTCGACAAAGAATCGACGATGCAAGCT
GCTGCCCCTGGTGATGGCTGCCCCGCTGAGCGTGGAACAGGGCACAGTGACCGTGGTGGGCATCCCCCCA
GAGACTGATAGCTCGGATAGAAAGAACTTTTTTGGTCGGGCTTTTGAGAAGGCAGCAGAAAGCACC
nt 1497 - nt 1912 of NM_009862.1
Notes:The Cdc45l probe used for radioactive insitu in this study by Kunte et al., 2001 [PMID:11578863] is described as follows: "A 415 bp Cdc45L mouse cDNA fragment was amplified by reverse-transcriptase-polymerase chain reaction (RT-PCR) using whole mouse embryo RNA (upper, 5'-ACCACTTCATCCAGGCTCTC-3'; lower, 5'-GGTGCTTTCTGCTGCCTTCT-3')." Editors note: It is assumed that this same probe was also used for the wholemount in situ as no other in situ probes were described by the authors.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Kunte A; Ivey K; Yamagishi C; Garg V; Yamagishi H; Srivastava D, 2001 [PMID:11578863] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00489-0] [ PMID:11578863] Kunte A, Ivey K, Yamagishi C, Garg V, Yamagishi H, Srivastava D 2001 A common cis-acting sequence in the DiGeorge critical region regulates bi-directional transcription of UFD1L and CDC45L. Mech Dev (108):81-92
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE