Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4739

Plag1 pleiomorphic adenoma gene 1 ( MGI:1891916)
TS19 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4739 EMAGE:4739 EMAGE:4739
Figure 2C. Copyright: This image is from [doi:10.1002/dvdy.20577] Alam S; Zinyk D; Ma L; Schuurmans C, "Members of the Plag gene family are expressed in complementary and overlapping regions in the developing murine nervous system." Dev Dyn 2005 Nov;234(3): 772-82. [PMID:16193498] Figure 2I. Copyright: This image is from [doi:10.1002/dvdy.20577] Alam S; Zinyk D; Ma L; Schuurmans C, "Members of the Plag gene family are expressed in complementary and overlapping regions in the developing murine nervous system." Dev Dyn 2005 Nov;234(3): 772-82. [PMID:16193498] Figure 2L. Copyright: This image is from [doi:10.1002/dvdy.20577] Alam S; Zinyk D; Ma L; Schuurmans C, "Members of the Plag gene family are expressed in complementary and overlapping regions in the developing murine nervous system." Dev Dyn 2005 Nov;234(3): 772-82. [PMID:16193498]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: b, branchial arch; di, diencephalon; fl, forelimb; hb, hindbrain; hl, hindlimb; m, midbrain; nt, neural tube; o, otic vesicle; ol, olfactory pit; oc, optic cup; t, telencephalon.
Expression Pattern Description
Spatial Annotation:
EMAGE:4739Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4739_wholemount_moderate_3D_1.wlz
4739_wholemount_weak_3D_1.wlz
4739_wholemount_notDetected_3D_1.wlz
4739_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4739_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
branchial arch
detected detected
tail somite
detected detected
regionalExpression in caudal somites.
limb
detected detected
rathke's pouch
detected detected
embryo
detected detected
regionalExpression in intersomital regions.
tail future spinal cord
detected detected
regionalExpression observed in the caudal spinal cord
neural tube
detected detected
regionalExpression in ventral regions of the neural tube.
hindbrain
detected detected
diencephalon
detected detected
midbrain
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Plag1 probeA
Entity Detected:Plag1, pleiomorphic adenoma gene 1 ( MGI:1891916)
Notes:The Plag1 probe used in this study by Alam et al., 2005 [PMID:16193498] was generated either using "IMAGE ID 6328180" or from a cDNA fragment which was generated by PCR using the primers "Plag1L: AATCTAGAGATGGCCACTGTCATTCCTGG; Plag1R: AATCTAGAGGCTACACA AGCACCTCGGGT". Editors note: the authors state that "Plag1 expression patterns were identical for both antisense probes", however they do not specify which was used in each assay.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:10.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Alam S; Zinyk D; Ma L; Schuurmans C, 2005 [PMID:16193498] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.20577] [ PMID:16193498] Alam S, Zinyk D, Ma L, Schuurmans C 2005 Members of the Plag gene family are expressed in complementary and overlapping regions in the developing murine nervous system. Dev Dyn (234):772-82
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE