Type: | in situ hybridisation probe |
Identifier: | Plag1 probeA |
Entity Detected: | Plag1, pleiomorphic adenoma gene 1 ( MGI:1891916) |
Notes: | The Plag1 probe used in this study by Alam et al., 2005 [PMID:16193498] was generated either using "IMAGE ID 6328180" or from a cDNA fragment which was generated by PCR using the primers "Plag1L: AATCTAGAGATGGCCACTGTCATTCCTGG; Plag1R: AATCTAGAGGCTACACA AGCACCTCGGGT".
Editors note: the authors state that "Plag1 expression patterns were identical for both antisense probes", however they do not specify which was used in each assay. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |